We narrowed to 172,329 results for: Gene
-
Plasmid#241005PurposeFor targeted gene knock-in at NHP IGH locus and B cell-specific expression of full-length 10-1074 following endogenous splicingDepositorInsert10-1074
UseAAV and CRISPRExpressionMammalianPromoterVH4Available SinceFeb. 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp High Copy FAM136A-HA WT
Plasmid#244883PurposeIn vitro transcription of wild-type FAM136A downstream of SP6 promoterDepositorAvailable SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp High Copy ENDOG-HA
Plasmid#244881PurposeIn vitro transcription of human ENDOG downstream of SP6 promoterDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-EGFP(miRE.FF4)-FMRP-TS.FF6x1-bGH]-EFS-rtTA-P2A-mRuby2-WPRE
Plasmid#235307PurposeLentiviral expression of ComMAND open-loop circuit regulating EGFP-FMRP (therapeutically relevant gene)DepositorInsertEGFP-Fmr1 (Fmr1 Mouse)
UseLentiviral and Synthetic BiologyTagsFLAGExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-FXN-P2A-mRuby2(miRE.FF4)-TS.FF6x1-bGH]-EFS-rtTA-P2A-mGL-WPRE
Plasmid#235304PurposeLentiviral expression of ComMAND open-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-EGFP(miRE.FF4)-FMRP-TS.FF4x1-bGH]-EFS-rtTA-P2A-mRuby2-WPRE
Plasmid#235308PurposeLentiviral expression of ComMAND closed-loop circuit regulating EGFP-FMRP (therapeutically relevant gene)DepositorInsertEGFP-Fmr1 (Fmr1 Mouse)
UseLentiviral and Synthetic BiologyTagsFLAGExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiX1-[TRE3G-FXN-P2A-mRuby2(miRE.FF4)-TS.FF4x1-bGH]-EFS-rtTA-P2A-mGL-WPRE
Plasmid#235305PurposeLentiviral expression of ComMAND closed-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterTRE3G (3rd-generation Tet system)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-TAZ-CAMTA1
Plasmid#235681PurposeExpress TAZ-CAMTA1 fusion gene in mammalian cells using the doxycycline-inducible TRE promoterDepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDonor-Prf1-ires-mCherry
Plasmid#209073PurposeTargeting vector for the mouse Prf1 locus to correct prf1 geneDepositorInsertPrf1-ires-mCherry HDR template (parts of Prf1 with mutated PAM) (Prf1 Mouse)
UseCRISPRAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDonor-Prf1-mock-ires-mCherry
Plasmid#209074PurposeTargeting vector for the mouse Prf1 locus to correct prf1 geneDepositorInsertPrf1-mock-ires-mCherry HDR template (parts of Prf1(S399Stop) with mutated PAM) (Prf1 Mouse)
UseCRISPRAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1
Plasmid#190902PurposeAAV vector expressing thew GFP reporter gene and human sgHTTDepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1-U6-sgCas9
Plasmid#190903PurposeAAV-KamiCas9 vector expressing expressing thew GFP reporter gene and sgHTT and sgCas9DepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch2#1/Cre
Plasmid#193225PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch2 geneDepositorAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRunx1t1#2/Cre
Plasmid#193236PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Runx1t1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTmem132d#1/Cre
Plasmid#193242PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tmem132d geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTmem132d#2/Cre
Plasmid#193243PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tmem132d geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only