We narrowed to 14,047 results for: crispr grnas
-
Plasmid#101924PurposeLEFTY2 gRNA used for targeted demethylation is inserted into the WPXL lentiviral backbone.DepositorInsertLEFTY2 enhancer targeting gRNA
UseLentiviralAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
WPXL SOX10 gRNA
Plasmid#101923PurposeSOX10 gRNA used for targeted demethylation is inserted into the WPXL lentiviral backbone.DepositorInsertSOX10 promoter targeting gRNA
UseLentiviralAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
B2M-SDMutation-gRNA
Plasmid#215547PurposegRNA targeting B2M to introduce splice donor mutation on the first intron of the locusDepositorInsertB2M (B2M Human)
UseCRISPRAvailable SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCriprV2-sgRNA-PER1-#2
Plasmid#189988PurposeLentiviral Cas9/sgRNA vector targeting C-terminus of hPER1, works with Addgene 189979-189982DepositorInsertPeriod1 (PER1 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PLOD2 sgRNA3
Plasmid#136458PurposeExpression of gRNA against human PLOD2DepositorInsertgRNA against human PLOD2 (PLOD2 Human, Synthetic)
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PLOD2 sgRNA5
Plasmid#136460PurposeExpression of gRNA against human PLOD2DepositorInsertgRNA against human PLOD2 (PLOD2 Human, Synthetic)
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-XYLT2-sgRNA
Plasmid#154862PurposeLentiviral expression of Cas9 and sgRNA targeting XYLT2DepositorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
human ETV6 gRNA-3
Plasmid#133403Purposehuman ETV6 gRNA-3 is a 20-nt gRNA expression plasmid targeting the second ETV6 exon.DepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9nucl-T2A-mCherry - BAKgRNA1- BAKgRNA2
Plasmid#167295PurposePlasmid encoding for 2 gRNAs targeting the human BAK gene and a CMV driven nuclease Cas9 followed by self-cleaving mCherryDepositorInsertBAK (BAK1 Human)
ExpressionMammalianAvailable SinceApril 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
gRNA-CasRx_SD1-pSV40-TagBFP
Plasmid#221004PurposeTransiently express CasRx DR30 repeat with gRNA spacer. Contains SD1 mutation to enhance efficiency. SV40-TagBFP cassette to monitor transfection efficiency. Use BbsI with overhangs Fw-AAAC, Rv-AAAA.DepositorInsertCasRx 30nt processed direct repeat with SD1 mutation
UseCRISPRExpressionMammalianMutationDR1 A>TPromoterU6Available SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
v1em-Cterm-PE2max-U6-pegRNA
Plasmid#198733PurposeAAV genome encoding C-terminal PE2max and U6 expression cassetteDepositorInsertNpuC-CtermPE2max
UseAAVPromoterEFSAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYES2-gRNA-hyg-MCS
Plasmid#107734PurposeE. coli-S. cerevisiae shuttle plasmid harbors gRNA expression cassettes targeting S. cerevisiae chromosomal X-3 site (HXK1 gene). Can function as a gRNA expression empty backbone plasmid.DepositorInsertX-3 site gRNA expression cassettes
UseCRISPRExpressionYeastPromoterSNR52pAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRNA(lib)-puro
Plasmid#119976PurposeLenti sgRNA cloning backbone with CMV-puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgRNA scaffold-spacer-human U6
Plasmid#214697Purposeprovide "sgRNA scaffold-spacer-human U6" fragmentDepositorInsertsgRNA scaffold-spacer-human U6
UseCRISPRAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA2-CTCF-prom
Plasmid#195104PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting upstream of the human CTCF promoter. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF promoter
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only