We narrowed to 11,657 results for: AGA

#126904

Gateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.

Sophien Kamoun

July 12, 2019

Academic Institutions and Nonprofits only

#240307

Donor:smFP-V5 KO:Gphn#1

Yuki Ogawa

July 11, 2025

Academic Institutions and Nonprofits only

#236553

Encodes Cas9 and two guideRNAs, one to cut the genome downstream of HSPA5 (BiP/GRP78) and one to linearize the DONOR plasmid.

Pablo Rivera-Fuentes

April 23, 2025

Academic Institutions and Nonprofits only

#127908

WT Cas9 Vector with Blasticidin Selection Marker targeting the 5' end of the human HP1beta gene

Mark Groudine

Sept. 12, 2019

Academic Institutions and Nonprofits only

#126892

Genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.

Sophien Kamoun

July 24, 2019

Academic Institutions and Nonprofits only

#126900

Gateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.

Sophien Kamoun

July 15, 2019

Academic Institutions and Nonprofits only

#73314

Pas2p peroxisomal membrane targeting sequence

T. J. Kappock

Feb. 26, 2016

Academic Institutions and Nonprofits only

#177232

Expresses Sik1(bU6), Sik2 (mU6) and Sik3 (hU6) gRNAs and Cre-recombinase

Monte Winslow

June 9, 2022

Academic Institutions and Nonprofits only

#110426

TRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.

Sandra Martha Gomes Dias

June 20, 2018

Academic Institutions and Nonprofits only