We narrowed to 17,963 results for: IGH@;
-
Plasmid#51852PurposeExpresses full-length Transmembrane emp24 domain-containing protein precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertTMED10 (TMED10 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
H6GB1tevP53SS(1-393)
Plasmid#200311PurposeBacterial expression of human superstable p53 as His6GB1tev fusionDepositorInsertp53 (TP53 Human)
TagsHis6-GB1-tevExpressionBacterialMutationM133L, V203A, N239Y, N268DPromoterT7Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
PDIA3-bio-His
Plasmid#52070PurposeExpresses full-length Protein disulfide-isomerase A3 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertPDIA3 (PDIA3 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Clover
Plasmid#40259PurposeGFP with robust performance in protein fusions and useful as FRET donor for mRuby2 in a FRET pair that offers bright fluorescence, dynamic range, and photostability while limiting emissions overlapDepositorHas ServiceCloning Grade DNAInsertClover GFP
ExpressionMammalianPromoterCMV IEAvailable SinceSept. 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
Tn7 integration plasmid
Plasmid#154134PurposeSuicidal integration plasmid with the Tn7 arms, streptomycin and kanamycin resistance genes and the restriction site to clone the barcode-carrying cassette.DepositorInsertsleft and right end of Tn7 arm
Spectinomycin resistant gene
ExpressionBacterialPromoterSpectinomycin resistance gene promoter and noAvailable SinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pORTMAGE-4
Plasmid#72679PurposeExpresses Lambda Red recombinases and a dominant negative MutL allele all controlled by temperature sensitve cI857 repressor for high precision and efficiency MAGE experiments. Cam resistance marker.DepositorInsertmutL E32K
TagsnoneExpressionBacterialMutationE32K mutation conferring dominant mutator phenoty…Available SinceFeb. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Cepheid1b-ST-WPRE
Plasmid#214967PurposeRed fluorescent, negative response-polarity voltage indicator under the control of synapsin promoter; soma-targeted; for brighter fluorescenceDepositorInsertCepheid1b-ST
UseAAVPromoterhuman SynapsinAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
BMR1_03g02090-bio-His
Plasmid#107674PurposeExpresses enzymatically monobiotinylated full-length BMR1_03g02090 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertBMR1_03g02090
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only