We narrowed to 11,575 results for: aga
-
Plasmid#45764DepositorAvailable SinceAug. 12, 2013AvailabilityAcademic Institutions and Nonprofits only
-
STARR-seq luciferase INF enhancer vector_ORI_IFI27
Plasmid#99320PurposeLuciferase validation vector with IFI27 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr14: 94575894-94578286
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
SIK3 gRNA (BRDN0001144776)
Plasmid#75754Purpose3rd generation lentiviral gRNA plasmid targeting human SIK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch2#2/Cre
Plasmid#193226PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch2 geneDepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cas9_YTHDF2_sgRNA
Plasmid#186673PurposeYTHDF2 sgRNA plasmidDepositorInsertYTHDF2 KO sgRNA Plasmid (YTHDF2 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_mP_SV40
Plasmid#99310PurposeLuciferase validation vector with SV40 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertSV40 enhancer
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRRL.SIN.EF1A.JAG1-F1.218.CAR-2G
Plasmid#194459PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); 4-1BB & CD3ζ (signaling domains); anti-JAG1 from J1.F1 in VL-VH order and 218 linker (scFv). GFP-Zeo for selection and monitoring.DepositorInsertAnti-JAG1 CAR
UseLentiviralAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 hCortKD-Flcortmut3YF EGFP
Plasmid#187263PurposeLentiviral expression of shRNA targeting Cortactin + reconstitution of Cortactin3YF mutantDepositorInsertCortactin (CTTN Human)
UseLentiviralTagsEGFPMutation3YF (Y412, Y470, Y486)PromoterU6, 5'LTRAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-lincRNA-RorR-sh2 (Linc-sh2)
Plasmid#45765DepositorAvailable SinceAug. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_3
Plasmid#155071PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
tet-pLKO.1_puro_shJUND #1
Plasmid#136581PurposeExpresses an inducible short hairpin targeting human JUND sequenceDepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA5 gRNA (BRDN0001145521)
Plasmid#77372Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA5DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p2xFLAGhYAP2-WW1-mutant
Plasmid#17795DepositorInsertYes-kinase associated protein (YAP1 Human)
Tags2xFlagExpressionMammalianMutationTryptophan 199 to Alanine; Proline 202 to AlanineAvailable SinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
p2xFLAGhYAP2-WW2-mutant
Plasmid#17796DepositorInsertYes-kinase associated protein (YAP1 Human)
Tags2xFlagExpressionMammalianMutationTryptophan 258 to Alanine Proline 261 to AlanineAvailable SinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSmad4#1/Cre
Plasmid#173617PurposeExpresses a Smad4-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Smad4 (Smad4 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
TTBK1 gRNA (BRDN0001145252)
Plasmid#75801Purpose3rd generation lentiviral gRNA plasmid targeting human TTBK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTBL681 CHYRON4 integration construct
Plasmid#126449PurposeTo integrate the CHYRON4 locus at AAVS1 in human cells.DepositorInsertspU6/3xLacO-CHYRON4 hgRNA
pCMV-puro
ExpressionMammalianMutationThe SpCas9 sgRNA constant region is mutated to ma…PromoterCMV and human U6/3xLacOAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only