We narrowed to 8,454 results for: gnal
-
Plasmid#216796PurposeInducible bicistronic lentiviral plasmid for the simultaneous expression of the D178Y mutant form of Connexin 32 and cytosolic GCaMP6sDepositorAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pFB-CG-LYCHOS WT-HA-GFP
Plasmid#199687PurposeExpression of LYCHOS WT in insect cellsDepositorAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) ∆DEP-HA
Plasmid#199683PurposeTransient expression of LYCHOS (GPR155) ∆DEP-HADepositorAvailable SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5 LYCHOS (GPR155) Y551A-HA
Plasmid#199676PurposeTransient expression of LYCHOS (GPR155) Y551A mutantDepositorAvailable SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28a LZ LED WT-FLAG
Plasmid#199679PurposeBacterial expression of Leucine Zipper (LZ) LYCHOS LED-FlagDepositorInsertLeucine zipper LYCHOS LED WT (GPR155 Human)
Tags6xHis and FlagExpressionBacterialPromoterT7 promoterAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) P44A-HA
Plasmid#199675PurposeTransient expression of LYCHOS (GPR155) P44A mutantDepositorAvailable SinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) E48Q-HA
Plasmid#199662PurposeTransient expression of LYCHOS (GPR155) E48Q mutantDepositorAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) F43I-HA
Plasmid#199674PurposeTransient expression of LYCHOS (GPR155) F43I mutantDepositorAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Myc-Nix-S35A
Plasmid#197562PurposeMammalian expression of myc-tagged human Nix with an alanine substitution of serine-35. Based on Myc-Nix (#100795)DepositorInsertBCL2 interacting protein 3 like (BNIP3L Human)
TagsMycExpressionMammalianMutationSerine 35 changed to alaninePromoterCMVAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
Myc-Nix-S35D
Plasmid#197563PurposeMammalian expression of myc-tagged human Nix with an aspartic acid substitution of serine-35. Based on Myc-Nix (#100795)DepositorInsertBCL2 interacting protein 3 like (BNIP3L Human)
TagsMycExpressionMammalianMutationSerine 35 changed to aspartic acidPromoterCMVAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dMET
Plasmid#176031PurposeA knock-out vector for dog METDepositorInsertA gRNA targeting the dog MET gene and the cDNA of Cas9 (MET )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-R/G-ICUE
Plasmid#181849PurposeICUE cAMP sensor using sfGFP and mRuby2 as the FRET donor and acceptor.DepositorInsertR/G-ICUE (RAPGEF3 Human)
TagsmRuby2 and sfGFPExpressionMammalianMutationGlutamine 122 in Epac1 domain mutated to glutamat…PromoterCMVAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
SOD1_pcDNA6.2/EmGFP-Bsd
Plasmid#176964PurposeMammalian expression vector encoding SOD1 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
ST-2xTstem(5A)-GFP
Plasmid#162504PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. One wildtype Tac stem region is inserted within ST and the other mutated Tac stem region is inserted between ST and GFP.DepositorTagsGFPExpressionMammalianMutationOne Tac stem region is inserted within ST6Gal1 an…Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
ST-2xTstem-GFP
Plasmid#162503PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. One Tac stem region is inserted within ST and the other Tac stem region is inserted between ST and GFP.DepositorTagsGFPExpressionMammalianMutationOne Tac stem region is inserted within ST6Gal1 an…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
JDW 249 (pTol2-Dll4-F2-ETS#2-WT-8X-E1b-EGFP)
Plasmid#156417Purpose8X copies of the ETS#2 site of the murine Dll4 intronic enhancer and a minimal E1b reporter driving expression of EGFP flanked by Tol2 sitesDepositorInsertmurine Dll4 F2-6/F8 ETS site B/ site #2, 8X
UseZebrafish transgenesisPromoterE1b min pro/b-globin intronAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA8-Flag-LARS (361-720aa)
Plasmid#139688PurposeExpresses N-teminal Flag tagged aa 361-720 of LARS1DepositorAvailable SinceJuly 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-eGFP-FRT-T0-RNF168 delta MIU1/MIU2
Plasmid#133980Purposeinducible mammalian expression vector of eGFP tagged RNF168 where both motifs interacting with ubiquitin have been deletedDepositorInsertRNF168 (RNF168 Human)
TagseGFPExpressionMammalianMutationdeletion of MIU1 and MIU2PromoterCMVAvailable SinceNov. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
Cry2 mcherry Gamma 9 in pcDNA3.1
Plasmid#64208PurposemCherry fused between Cry2 and gamma 9 to study cell migrationDepositorTagsmcherry and n/aExpressionMammalianPromoterCMVAvailable SinceJune 2, 2015AvailabilityAcademic Institutions and Nonprofits only