We narrowed to 1,329 results for: AAV Cas9
-
Plasmid#86696PurposeTetracycline inducible expression of guide RNA targeted to AAVS1 locusDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterH1 TOAvailable sinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-dSa-VPR
Plasmid#99651PurposeExpresses tripartite VP64-p65-RTA activator fused to C term. of dead Sa Cas9DepositorInsertdCas9
UseAAVTagsVP64-p65-RTA activatorExpressionMutationdead Cas9PromoterAvailable sinceJan. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-dSa-VP64-p65(100-261)-RTA(125-190)
Plasmid#99679PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domainsDepositorArticleInsertdCas9
UseAAVTagsVP64-p65(101-261)-RTA(125-190)ExpressionMutationdead Cas9PromoterAvailable sinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Afp
Plasmid#99697PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Afp promoter, vector allows for activation of mouse Afp, can be packaged and delivered as AAVDepositorInsertdCas9 and gRNA targeting Afp (Afp Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_sgRNA
Plasmid#100554PurposeExpresses AAVS1 sgRNA. Target sequence: GGGGCCACTAGGGACAGGATDepositorInsertAAVS1 sgRNA
UseTagsExpressionMutationPromoterU6Available sinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA-CMV-GFP
Plasmid#85451PurposeExpress sgRNA in mammalian cellsDepositorInsertpCMV-EGFP
UseAAVTagsExpressionMutationPromoterpCMV-EGFPAvailable sinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-tLuc-mCherry
Plasmid#107553PurposetLuc-mCherry in AAV backboneDepositorTypeEmpty backboneUseAAVTagsExpressionMutationPromoterAvailable sinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa-VPR mini.-2X snRP1
Plasmid#99688PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains with 34 nt dual snRP1 poly adenylation signalDepositorArticleInsertdCas9
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa-VPR mini.-syn pA
Plasmid#99689PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains with syn pA (poly adenylation) signalDepositorArticleInsertdCas9
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa-VPR mini.-1X snRP1
Plasmid#99687PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains with 17 nt snRP1 poly adenylation signalDepositorArticleInsertdCas9
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HR donor
Plasmid#97317PurposeHR donor for fusing a p2A-mCherry reporter to mouse Actb.DepositorInsertActb HR donor
UseAAV and Mouse TargetingTagsExpressionMammalianMutationPromoterAvailable sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
gRNA_AAVS1-T2
Plasmid#41818PurposeExpresses a guide RNA (gRNA) to target human AAVS1 (T2 target sequence) for genome engineeringDepositorInsertgRNA_AAVS1-T2
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
gRNA_AAVS1-T1
Plasmid#41817PurposeExpresses a guide RNA (gRNA) to target human AAVS1 (T1 target sequence) for genome engineeringDepositorInsertgRNA_AAVS1-T1
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV MCS mCherry-KASH
Plasmid#139654PurposeCloning template for AAV-based ORANGE knock-in constructsDepositorTypeEmpty backboneUseAAVTagsExpressionMammalianMutationPromoterU6Available sinceJune 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNM220_AAVS1 integration helper
Plasmid#211864PurposeCas9 cutting at AAVS1 safe harbor locusDepositorInsertAAVS1
UseCRISPRTagsExpressionMutationN/APromoterAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc.U6-sgFah.CMV/CB-EGFP
Plasmid#121508PurposeExpresses sgRNA targeting mouse Fah intron 7 (sgFah).DepositorInsertsgFah
UseAAVTagsExpressionMammalianMutationPromoterU6Available sinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc.U6-sgGTTG.CMV/CB-Gluc
Plasmid#121512PurposeExpresses sgRNA targeting the intron in the MADM alleles (GT and TG).DepositorInsertsgGTTG
UseAAVTagsExpressionMammalianMutationPromoterU6Available sinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only