We narrowed to 4,533 results for: Gaa
-
Plasmid#240298PurposeKI:Lmnb1 Donor:3xV5 KO:Mecp2DepositorInsertKI gRNA for Lmnnb1
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_NC_chr2
Plasmid#214683PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human non-coding DNA region of chromosome 2 (negative control)DepositorInsertdgRNA_Chr2
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-[BsaI_cassette]-SpCas9_sgRNA_scaffold (MSP3485)
Plasmid#140082PurposeEntry cloning vector for in vitro transcription or expression of SpCas9 sgRNAs from a T7 promoterDepositorInsertpT7-[BsaI_cassette]-SpCas9_sgRNA_scaffold (MSP3485)
UseIn vitro transcription (mrna synthesis)ExpressionBacterialPromoterT7Available SinceOct. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAIO-Ef1a-PE2-GFP:KCNQ2-C201R
Plasmid#185060PurposeEf1a driven PE2 plasmid with pegRNA for editing C201R mutation in KCNQ2 gene. See Addgene plasmid #184445DepositorInsertU6:pegRNA:scaffold:PBS+RT template
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-CTBP2-MGMT_1
Plasmid#136419PurposeLentiviral expression of gRNAs targeting intron 1 of human CTBP2 and intron 1 of human MGMT. Also constitutively expresses Puromycin fused to TagBFP.DepositorInsertU6_sgRNA(CTBP2)_U6_sgRNA(MGMT)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shDLD #1
Plasmid#242706PurposeshRNA knockdown human DLD geneDepositorInsertDLD (DLD Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
HCP4
Plasmid#166106PurposeThis plasmid encodes a Cas9 protein as well as two sgRNAs, one targets the center of Cyr1 and the other targets a non-coding region on chromosome X (location X1)DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP6
Plasmid#166108PurposeThis plasmid encodes a Cas9 protein as well as two sgRNAs, one targets the C-terminus of Cyr1 and the other targets a non-coding region on chromosome X (location X1)DepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZNF169.2.0-gDNA
Plasmid#112472PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF169DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
PJEBAN4
Plasmid#203683PurposeExpresses red fluorescent marker HcRed in Listeria monocytogenesDepositorInsertHcRed
ExpressionBacterialAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEX-A-U6-MaSgRNA_PuroR
Plasmid#84780PurposeExpresses major satellite-specific sgRNA.DepositorInsertmajor satellite-specific sgRNA
UseCRISPRExpressionBacterial and MammalianPromoterU6Available SinceJuly 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
(pRZ75) AAV: U6-gRNA(cs1)-EF1a-Cre-P2A-mCherry
Plasmid#254581PurposeAAV backbone expressing Cre recombinase and mCherry from the EF1a promoter and one U6-driven sgRNA with SapI spacer and capture sequence in scaffoldDepositorInsertCre
UseAAVAvailable SinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgENPP1_#3-hygro
Plasmid#254680Purposeknockout human ENPP1DepositorInsertsgRNA with Cas9 and hygromycin resistance (ENPP1 Human)
UseCRISPR and LentiviralAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgENPP1_#2-hygro
Plasmid#254679Purposeknockout human ENPP1DepositorInsertsgRNA with Cas9 and hygromycin resistance (ENPP1 Human)
UseCRISPR and LentiviralAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgENPP1_#1-hygro
Plasmid#254678Purposeknockout human ENPP1DepositorInsertsgRNA with Cas9 and hygromycin resistance (ENPP1 Human)
UseCRISPR and LentiviralAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAIO-Ef1a-PE2-GFP:KCNQ2-C201R_pp
Plasmid#185061PurposeEf1a driven PE2 with pegRNA for editing C201R mutation (including silent PAM mutation) in KCNQ2. See Addgene plasmid #184445DepositorInsertU6:pegRNA:scaffold:PBS+RT template
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-mAK1-shRNA-1
Plasmid#185364PurposeFor mammalian expression of shRNA: ATCTTGACTCCCTGAAGTAAC that targets mouse AK1 (adenylate kinase)DepositorAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZFP1.1.0-gDNA
Plasmid#112470PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZFP1DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
BS.YxiN.Twin1.a1-479.E152Q
Plasmid#17518DepositorInsertB. subtilis DEAD-box helicase YxiN
Tagsintein-chitin binding domainExpressionBacterialMutationE152Q mutationAvailable SinceMarch 21, 2008AvailabilityAcademic Institutions and Nonprofits only