-
Plasmid#117144PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v5 (Dmap1 Synthetic)
UseCRISPR and LentiviralTagsExpressionMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable sinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v1)-PGK-Puro-BFP
Plasmid#117140PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v1 (Dmap1 Synthetic)
UseCRISPR and LentiviralTagsExpressionMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable sinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v2)-PGK-Puro-BFP
Plasmid#117141PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v2 (Dmap1 Synthetic)
UseCRISPR and LentiviralTagsExpressionMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable sinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-Diras2_2-hSyn::mCherry.3xFLAG-WPRE
Plasmid#120394PurposepAAV plasmid expressing Diras2 shRNA2 under the U6 promoter and mCherry.3XFLAG under the hSyn promoterDepositorInsertDiras2 shRNA (Diras2 Mouse)
UseAAV and RNAiTagsmCherry.3XFLAGExpressionMutationPromoterU6Available sinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-U6-sgRNA-M7-IRES-CFP
Plasmid#114730PurposesgRNA targeting a sequence upstream of the initiator ATG of the cellular Myc geneDepositorInsertsgRNA M7
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-U6-sgRNA-M5-IRES-CFP
Plasmid#114728PurposesgRNA targeting a sequence upstream of the initiator ATG of the cellular Myc geneDepositorInsertsgRNA M5
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 n.s shRNA L1-L4
Plasmid#62136PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and a non-silencing (scrambled) shRNA module. Compatible with MultiSite Gateway cloningDepositorInsertnon-silencing (scrambled) shRNA
UseRNAi; Mule gateway entry vectorTagsExpressionMammalianMutationPromoterU6Available sinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 n.s shRNA R4-R3
Plasmid#62137PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and a non-silencing (scrambled) shRNA module. Compatible with MultiSite Gateway cloningDepositorInsertnon-silencing (scrambled) shRNA
UseRNAi; Mule gateway entry vectorTagsExpressionMammalianMutationPromoterU6Available sinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 n.s shRNA L5-L2
Plasmid#62139PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and a non-silencing (scrambled) shRNA module. Compatible with MultiSite Gateway cloningDepositorInsertnon-silencing (scrambled) shRNA
UseRNAi; Mule gateway entry vectorTagsExpressionMammalianMutationPromoterU6Available sinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pF(UG) U6-SYT7 sgRNA 777 HaloTag
Plasmid#179724PurposeU6-driven SYT7 gRNA and HaloTag lentiviral vector for CRISPR/HITIDepositorInsertsgRNA and HaloTag
UseLentiviralTagsExpressionMutationPromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
Multiple Lentiviral Expression (MuLE) system
Plasmid Kit#1000000060PurposeMultiple Lentiviral Expression (MuLE): modular system used to construct complex lentiviruses for modification of mammalian cells with a single viral infection.DepositorAvailable sinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
(565) pAAV Alb-AAT KRAB-SadCas9 U6-gSTOP
Plasmid#163030PurposeExpression of CRISPRi with gSTOP gRNADepositorInsertMammalian codon-optimized SadCas9
UseAAVTagsKRAB, SV40 pA, and myc NLSExpressionMammalianMutationPromoterAlb-AATAvailable sinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
(564) pAAV Alb-AAT KRAB-SadCas9 U6-mPcsk9
Plasmid#163025PurposeExpression of CRISPRi with gRNA against mouse Pcsk9DepositorInsertMammalian codon-optimized SadCas9 (Pcsk9 S. aureus)
UseAAVTagsKRAB, SV40 pA, and myc NLSExpressionMammalianMutationPromoterAlb-AATAvailable sinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-EF1aCore-SaCas9-dual(U6-sgRNA(backbone))-ITR
Plasmid#207878PurposeAAV vector encoding EF1a core promoter-driven SaCas9 and two sgRNA cloning sites w/ the engineered Sa Guide scaffold variant (BbsI and PaqCI for sgRNA cloning).DepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-EF1aCore-SaCas9-single(U6-sgRNA(backbone))-ITR
Plasmid#207880PurposeAAV vector encoding EF1a core promoter-driven SaCas9 and single sgRNA cloning site w/ the engineered Sa Guide scaffold variant (BbsI for sgRNA cloning).DepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Tornado-F30-Broccoli-aptNFkB#5
Plasmid#124362PurposeOverexpression of bifunctional circular RNA (Broccoli fluorescence and NFkB binding)DepositorInsertTornado-F30-Broccoli-aptNFkB#5
UseTagsExpressionMammalianMutationPromoterU6+27Available sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA(HEK3)-CMV-SpCas9(D10A)-P2A-EGFP
Plasmid#221233PurposeExpress sgRNA targeting HEK3 loci with nCas9(D10A)DepositorInsertSpCas9(D10A)-P2A-EGFP
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA BfuAI large stuffer
Plasmid#52628Purposelentiviral U6 driven sgRNA cloning vector where guide sequences are inserted between BfuAI sites, improved cassette cloning efficiencyDepositorInsertKanamycin cassette
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceApril 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110)
Plasmid#71707PurposeA human codon-optimized SpCas9 fused to first 110 amino acids of human GEMININ and chimeric guide RNA expression plasmidDepositorInserthumanized S. pyogenes Cas9 fused to human Geminin (GMNN Human)
UseCRISPRTags3xFLAG and hGEM(1/110)ExpressionMammalianMutationPromoterCBhAvailable sinceFeb. 17, 2016AvailabilityAcademic Institutions and Nonprofits only