We narrowed to 2,494 results for: pcas9
-
Plasmid#207375PurposeExpression of increased-fidelity (i.e. high-fidelity) SpCas9 variant in bacterial cellsDepositorInsertBlackjack SpCas9
UseCRISPRTags6xHisExpressionBacterialMutationamino acids 1005-1013 replaced with two glycinePromoterT7Available SinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-gRNA(SFTPCI73Tcorr)-SpCas9(BB)-2A-GFP
Plasmid#187647PurposeEncodes gRNA to correct the SFTPC I73T mutationDepositorInsertI73T gRNA
UseCRISPRAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-RDH11
Plasmid#161924PurposeTo generate RDH11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against RDH11 exon 2.DepositorInsertsgRNA targeting RDH11 exon 2
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJCC_162 SpCas9 KES(1107-1109)GG
Plasmid#179526PurposeFor bacterial expression of SpCas9 KES(1107-1109)GG (phosphate lock loop mutant) with an N-terminal His-MBP tagDepositorInsertSpCas9 KES(1107-1109)GG
Tags10X His, TEV protease cleavage site, and maltose-…ExpressionBacterialMutationreplaced KES (residues 1107-1109) with GGAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-B2
Plasmid#165083PurposegRNA 2 of pair B for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-C1
Plasmid#165085PurposegRNA 1 of pair C for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-C2
Plasmid#165086PurposegRNA 2 of pair C for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459V2.0-eSpCas9(1.1)+K810A+K855A
Plasmid#108299PurposepX459 V2.0 (Plasmid #62988) with the K810A, K848A, K855A, K1003A, and R1060A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-CBE4max-SpCas9-NG-P2A-EGFP (RTW4554)
Plasmid#140001PurposeCAG promoter expression plasmid for human codon optimized BE4max C-to-T base editor with SpCas9-NG(D10A/L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R) and P2A-EGFPDepositorInserthuman codon optimized CBE4max SpCas9-NG with P2A-EGFP
UseCRISPRTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpCas9-NG=L1111R/D1135V/G1218R/E121…PromoterCAGAvailable SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti spCas9 T2A iRFP670 P2A puro
Plasmid#122182PurposeThe plasmid codes for a Flag-spCas9 protein, a iRFP670 fluorescent protein and a puromycin resistance. The plasmid has two BsmBI acceptor sites to insert gRNA expressing sequences.DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
C-term AAV-SpCas9-VRQR-gRNA_entry (HES1477)
Plasmid#242660PurposeCBh promoter expression plasmid for C-terminal intein-split AAV construct with C-term of SpCas9-VRQR and pU6 SpCas9 gRNA entry cassetteDepositorInsertpAAV-pCbh-BPNLS-NpuC-SpCas9-VRQR-BPNLS-WPRE-bGH_PA-SpCas9_gRNA_entrycassette
UseAAV and CRISPRTagsBPNLSMutationVRQR mutations in SpCas9(S55R/D1135V/G1218R/R1335…PromoterCBhAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
N-term AAV-ABE8e-SpCas9(S55R) (CA21)
Plasmid#242659PurposeCBh promoter expression plasmid for N-terminal intein-split AAV construct with N-term of ABE8e-SpCas9(S55R) - to be used with eVRQR constructsDepositorInsertpAAV-pCBh-BPNLS(SV40)-TadA8e-gs-SpCas9(D10A;S55R)-[N-term]-NpuN-BPNLS(SV40)-WPRE-bGH_PA
UseAAV and CRISPRTagsBPNLS and NpuN(intein)-BPNLSMutationSpCas9(S55R)PromoterCBhAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
p2T-cmv-SpCas9-TadCBEd-V106W-BlastR
Plasmid#193849PurposeExpress TadCBEd-V106W in mammalian cells with BlastR selection, Tol2 integrationDepositorInsertTadCBEd-V106W
ExpressionMammalianAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiSIV hSyn HA-NLS-SpCas9-NLS WPRE
Plasmid#236242PurposeLentiviral expression of SpCas9DepositorInsertSpCas9
UseLentiviralPromoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only