We narrowed to 7,128 results for: lentiviral plasmid
-
Plasmid#218662PurposeKnockout vector for human GOLIM4 (GPP130/GOLPH4)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only
-
PLKO.1-UPF3A-CDS
Plasmid#136043PurposeUPF3A shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCAGAAACCATTCTAAAGAAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
IDG_CLIC5_OE_1
Plasmid#161641PurposeOverexpresses CLIC5DepositorAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
IDG_CACNB4_OE_1
Plasmid#161686PurposeOverexpresses CACNB4DepositorAvailable SinceMarch 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
IDG_KCNC4_OE_1
Plasmid#161689PurposeOverexpresses KCNC4DepositorAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
IDG_KCNH6_OE_1
Plasmid#161669PurposeOverexpresses KCNH6DepositorAvailable SinceMarch 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
IDG_KCNMB3_OE_1
Plasmid#161703PurposeOverexpresses KCNMB3DepositorAvailable SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
IDG_KCNH8_OE_1
Plasmid#161702PurposeOverexpresses KCNH8DepositorAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
IDG_CNGA4_OE_1
Plasmid#161675PurposeOverexpresses CNGA4DepositorAvailabilityAcademic Institutions and Nonprofits only -
pET3a aSyn murine
Plasmid#108865PurposeExpresses murine alpha synucleinDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
IDG_CHRND_OE_1
Plasmid#161688PurposeOverexpresses CHRNDDepositorAvailabilityAcademic Institutions and Nonprofits only -
IDG_KCNAB2_OE_1
Plasmid#161647PurposeOverexpresses KCNAB2DepositorAvailable SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
DD-Cas9 with filler sequence and Venus (EDCPV)
Plasmid#90085PurposeThis plasmid contains destabilized Cas9 and has Venus after P2A sequence. This vector also contains filler sequence which required to be removed for cloning of desired sgRNADepositorInsertCas9
UseCRISPR and LentiviralTagsDestabilized Domain and FlagExpressionMammalianPromoterEFSAvailable SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
scFv-sfGFP-DNMT3A1
Plasmid#102278PurposeThe plasmid encodes a single-chain antibody that binds to the GCN4 peptide from the SunTag system, and is fused to a DNA methyltransferase DNMT3A1DepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pABpuro-BluF
Plasmid#46824Purposeluciferase reporter for BmalI promoterDepositorInsertBmal1 (Bmal1 Mouse)
UseLentiviral and LuciferaseTagsluciferaseExpressionMammalianPromoterBmal1Available SinceJuly 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti HRE-Luc pGK Hygro
Plasmid#118706Purposereporter plasmid HIF-responsive promoter (3xHRE) wt- fused to firefly luciferaseDepositorInsertHRE (HIF-responsive promoter (3xHRE)-luc
UseLentiviralAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTFG011_Spike_Parental_D614G_3xFlag
Plasmid#191571PurposeSARS-CoV-2 Spike protein under CMV with D614G, C-term 19 amino acid truncation, and 3x FLAG. For expression and pseudotyping lentiviral particles.DepositorInsertSARS-CoV-2 Spike Protein (S Synthetic)
Tags3x FLAGExpressionMammalianMutationD614G mutation. Last 19 amino acids truncated.PromoterCMVAvailable SinceJuly 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-IFNA-neo
Plasmid#225710PurposeThe pCDH-IFNA-neo plasmid is designed for the overexpression of human IFNα in mammalian cells. This plasmid was utilized to engineer A549 cells for stable IFNα overexpression.DepositorAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWPXL-c-Myc
Plasmid#36980DepositorAvailable SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
ACE2
Plasmid#164219PurposeExpresses full length human ACE2 protein, along with TagBFP reporter and Puromycin selection markerDepositorInsertACE2 (ACE2 Human)
UseLentiviralMutationsilent mutation to remove internal EcoRI site (GA…PromoterCMVAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only