We narrowed to 7,297 results for: Mag;
-
Plasmid#246731PurposeMammalian expression of human DNAJC5 L116 deleted with a mCerulean tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsmCeruleanExpressionMammalianMutationdelL116PromoterCMVAvailable SinceDec. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCitrine-DNAJC5
Plasmid#246733PurposeMammalian expression of human DNAJC5 wildtype with a mCitrine (YFP) tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsmCitrineExpressionMammalianPromoterCMVAvailable SinceDec. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-ActinVhh-sfGFP-P2A-HA-tdiRFP-caax (JDW 1532)
Plasmid#242606PurposeA CAGGS driven expression vector containing an actin nanobody fused to sfGFP to label actin followed by a HA tagged tdiRFP fused to a caax tag to label the cell membrane.DepositorInsertActin Vhh-sfGFP-P2A-HA-tdiRFP-caax
ExpressionMammalianPromoterCAGGSAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-RAD54L2-D1315-1467-SFB
Plasmid#247919PurposeMammalian expression construct for C-terminal S protein-Flag-Streptavidin binding peptide (SFB)-tagged RAD54L2 D1315-146DepositorInsertRAD54L2 (RAD54L2 Human)
UseLentiviralTagsS protein-Flag-Streptavidin binding peptide (SFB)ExpressionMammalianMutationdeletion of amino acid 1315-1467Available SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-RAD54L2-D87-291-SFB
Plasmid#247914PurposeMammalian expression construct for C-terminal S protein-Flag-Streptavidin binding peptide (SFB)-tagged RAD54L2 D87-29DepositorInsertRAD54L2 (RAD54L2 Human)
UseLentiviralTagsS protein-Flag-Streptavidin binding peptide (SFB)ExpressionMammalianMutationdeletion of amino acid 87-291Available SinceDec. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6 FLAG-DNAJC5
Plasmid#246740PurposeMammalian expression of human DNAJC5 with L116 deleted, and a FLAG tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsFLAGExpressionMammalianPromoterCMVAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF-1α-Venus-Nup107-FRT
Plasmid#247344PurposeExpresses Venus-NUP107 under EF1 promoter and can be integrated into FRT siteDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-dCas9(sa)-VP64-AAV
Plasmid#213035PurposedCas9-VP64 expressed under control of TREDepositorInsertdCas9
UseAAV and CRISPRTagsNLS and NLS-VP64PromoterTRE, miniCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPK_sgRNA_4
Plasmid#242899PurposePiggyBac cargo vector with HNRNPK sgRNA 4 for dox-inducible knockdownDepositorAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
p5E-hs_UbiC-pro (JDW 1461)
Plasmid#242547PurposeEnhancer/Promoter: Gateway 5' entry vector containing human Ubc promoter (-1225 to -6)DepositorInsertUbiquitin / Ubc promoter (UBC Human)
UseGateway subcloningAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPK_sgRNA_1
Plasmid#242897PurposePiggyBac cargo vector with HNRNPK sgRNA 1 for dox-inducible knockdownDepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPK_sgRNA_3
Plasmid#242898PurposePiggyBac cargo vector with HNRNPK sgRNA 3 for dox-inducible knockdownDepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-EGFP-Myc (JDW 1441)
Plasmid#242569PurposeGateway middle entry clone containing EGFP fused to oncogenic c-Myc.DepositorInsertc-Myc (MYC Human)
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-3-GST-Tev-Af1521(K35E/Y145R)-myc
Plasmid#196241PurposeN-terminal GST fusion of Af1521(K35E/Y145R) with a TEV protease site located between the GST tag and Af1521 and a myc tag on the C terminusDepositorInsertN-terminal GST fusion of Af1521(K35E/Y145R) with a TEV protease site between GST and Af1521 encoding a C-terminal myc tag
TagsGST tag and myc tagExpressionBacterialMutationamino acid 35 lysine is replaced with glutamic ac…Available SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-pSyn_R-PTEN
Plasmid#227437PurposeExpression of the R-PTEN sensor under the Synapsin promoter in an AAV backboneDepositorInsertR-PTEN sensor (Pten Rat)
UseAAVTagsmCyRFP2 and mMaroonExpressionMammalianMutationR14GPromoterSynapsinAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-HP1a-gRNA-2
Plasmid#237635PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to HP1a locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-SS18-SSX1-KS
Plasmid#237679PurposeFor overexpression of mEGFP-SS18-SSX1-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-SS18-SSX1
Plasmid#237678PurposeFor overexpression of mEGFP-SS18-SSX1DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only