We narrowed to 28,285 results for: gan
-
Plasmid#179204PurposePacr-2::Ca -insensitive D3cpv unc-54 3' UTR C.elegans neural expression of Pacr-2 calcium D3cpvDepositorInsertD3cpv
ExpressionWormPromoterPacr-2Available SinceFeb. 22, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH2157
Plasmid#179204PurposePacr-2::Ca -insensitive D3cpv unc-54 3' UTR C.elegans neural expression of Pacr-2 calcium D3cpvDepositorInsertD3cpv
ExpressionWormPromoterPacr-2Available SinceFeb. 22, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRS416-PTEF1-MCP-3P-ECM33_intron
Plasmid#127601Purposelow-copy URA-selectable plasmid, 1xFLAG-MCP under TEF1 promoter, 3P-ECM33 intron inserted into URA3DepositorInsertECM33 intron with MS2 hairpins inserted near 3′ end of intron
ExpressionYeastAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS416-PTEF1-MCP-3P-ECM33_intron
Plasmid#127601Purposelow-copy URA-selectable plasmid, 1xFLAG-MCP under TEF1 promoter, 3P-ECM33 intron inserted into URA3DepositorInsertECM33 intron with MS2 hairpins inserted near 3′ end of intron
ExpressionYeastAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS416-PTEF1-MCP-5P-ECM33_intron
Plasmid#127599Purposelow-copy URA-selectable plasmid, 1xFLAG-MCP under TEF1 promoter, 5P-ECM33 intron inserted into URA3DepositorInsertECM33 intron with MS2 hairpins inserted near 5′ end of intron
ExpressionYeastAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS416-PTEF1-MCP-5P-ECM33_intron
Plasmid#127599Purposelow-copy URA-selectable plasmid, 1xFLAG-MCP under TEF1 promoter, 5P-ECM33 intron inserted into URA3DepositorInsertECM33 intron with MS2 hairpins inserted near 5′ end of intron
ExpressionYeastAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS416-PTEF1-MCP-ECM33_intron
Plasmid#127598Purposelow-copy URA-selectable plasmid, 1xFLAG-MCP under TEF1 promoter, ECM33 intron inserted into URA3DepositorInsertECM33 intron
ExpressionYeastAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS416-PTEF1-MCP-ECM33_intron
Plasmid#127598Purposelow-copy URA-selectable plasmid, 1xFLAG-MCP under TEF1 promoter, ECM33 intron inserted into URA3DepositorInsertECM33 intron
ExpressionYeastAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
pCZGY2750
Plasmid#135094PurposeSite specific CRISPR/Cas9 editing of C. elegans Chr IVDepositorInsertsgRNA for cxTi10082 (actgttggatgcctgtgtag)
UseCRISPRExpressionWormPromoterU6Available SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCZGY2750
Plasmid#135094PurposeSite specific CRISPR/Cas9 editing of C. elegans Chr IVDepositorInsertsgRNA for cxTi10082 (actgttggatgcctgtgtag)
UseCRISPRExpressionWormPromoterU6Available SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pANTO3
Plasmid#131107PurposeTo generate a replicative plasmid carrying mycobacteriophage L5 integraseDepositorInsertmycobacteriophage L5 integrase
ExpressionBacterialAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pANTO3
Plasmid#131107PurposeTo generate a replicative plasmid carrying mycobacteriophage L5 integraseDepositorInsertmycobacteriophage L5 integrase
ExpressionBacterialAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDC24
Plasmid#131368Purposeexpression of MEG-3Cterm (aa545-862) in C. elegansDepositorAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDC24
Plasmid#131368Purposeexpression of MEG-3Cterm (aa545-862) in C. elegansDepositorAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only