We narrowed to 6,411 results for: kit
-
Plasmid#220592PurposeRetroviral vector with Ametrine marker for expression shRNA with an "UltramiR" microRNA scaffoldDepositorInsertGot1 shRNA (Got1 Mouse)
UseRetroviralTagsExpressionMutationPromoterAvailable sinceAug. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-DCK-Hygro
Plasmid#202409PurposegRNA expression vector for DCKDepositorInsertguide RNA (DCK Human)
UseCRISPR and LentiviralTagsDckExpressionMutationPromoterU6Available sinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSN687
Plasmid#177363PurposeExpresses human KIF1A(1-393)(P305L) fused with leucine zipper and His tagDepositorInsertKIF1A (KIF1A Human)
UseTagsHis tag and Leucine zipperExpressionBacterialMutationchanged Proline 305 to LeucinePromoterT7Available sinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5-ChR2-YFP
Plasmid#178722PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of ChR2-YFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertChR2-YFP
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6-ChR2-YFP
Plasmid#178723PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of ChR2-YFP in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertChR2-YFP
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-ChR2-YFP
Plasmid#178724PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of ChR2-YFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertChR2-YFP
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS6-ChR2-YFP
Plasmid#178726PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of ChR2-YFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertChR2-YFP
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6-V5-APEX2-NES
Plasmid#178700PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of V5-APEX2-NES in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertV5-APEX2-NES
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-V5-APEX2-NES
Plasmid#178704PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of V5-APEX2-NES in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertV5-APEX2-NES
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS3-TeTLc-P2A-mCherry
Plasmid#178708PurposeAAV vector for Flp-dependent transgene expression of TeTLc-P2A-mCherry in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertTeTLc-P2A-mCherry
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD4-V5-APEX2-NES
Plasmid#178698PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of V5-APEX2-NES in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertV5-APEX2-NES
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5-V5-APEX2-NES
Plasmid#178699PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of V5-APEX2-NES in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertV5-APEX2-NES
UseAAVTagsExpressionMutationPromoterAvailable sinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
DHC1-mIAA17 Hygro
Plasmid#140544PurposeDHC1 tagging with mIAA7DepositorInsertDHC1 (DYNC1H1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MCP-dNS-SRRM1-V5-mCherry
Plasmid#235095PurposeSRRM1 lacking Nuclear Speckle domain (dNS-SRRM1) mCherry fusion protein with MCP domainDepositorInsertpCAG-MCP-dNS-SRRM1-V5-mCherry (SRRM1 Human)
UseTagsExpressionMammalianMutationThe SRRM1 entry clone from DNASU was modified usi…PromoterCAGAvailable sinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpyTag-Flag-dNS-SRRM1-V5-mCherry
Plasmid#235096PurposeSRRM1 lacking Nuclear Speckle domain (dNS-SRRM1) mCherry fusion protein without MCP domainDepositorInsertpCAG-SpyTag-Flag-dNS-SRRM1-V5-mCherry (SRRM1 Human)
UseTagsExpressionMammalianMutationThe SRRM1 entry clone from DNASU was modified usi…PromoterCAGAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-Cas9-T2A-EGFP-ires-puro
Plasmid#78311PurposeExpresses WT SpCas9, EGFP and Puromycin resistance from a CAG promoter.DepositorInsertWT SpCas9-T2A-EGFP-ires-puromycin resistance
UseCRISPRTagsT2A-EGFP-ires-puroExpressionMammalianMutationPromoterCAGAvailable sinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4-AARE-luc2P-Hygro
Plasmid#101787PurposeLuferase reporter plasmid containing three tandem repeats of the amino acid response element (AARE)DepositorInsert3xAARE
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterminimal TATA-box promoter with low basal activityAvailable sinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
LMPd Amt OXCT1
Plasmid#209407PurposeRetroviral vector with Ametrine marker for expressing shRNA with an "UltramiR" microRNA scaffoldDepositorInsertOxct1 shRNA (Oxct1 Mouse)
UseRetroviralTagsExpressionMutationPromoterAvailable sinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mTagBFP2-CAAX2 WPRE
Plasmid#236231PurposeAAV expression of a fluorescent marker, mTagBFP2, fused to the plasma membrane targeting sequence CAAX2DepositorInsertmTagBFP2 fused to the plasma membrane targeting sequence CAAX2
UseAAVTagsmTagBFP2ExpressionMutationPromoterhuman Synapsin 1Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only