We narrowed to 6,576 results for: kit
-
Plasmid#217341PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only
-
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pST-KiT
Plasmid#44562Purposefor integrative inducible expression of mycobacterial proteinsDepositorTypeEmpty backboneUseE.coli-mycobacteria shuttle vectorTagsFlag tag and His tagExpressionBacterialAvailable SinceFeb. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
SI16-Kit a
Plasmid#58948Purposeexpresses recombinant mouse anti-Kit a receptor (zebrafish) IgG1 antibody in mammalian cellsDepositorAvailable SinceDec. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pC-KIT8
Plasmid#118990PurposeMutational dissection of the G rich region of the c-kit promoterDepositorAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pC-KIT5
Plasmid#118987PurposeMutational dissection of the G rich region of the c-kit promoterDepositorAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pC-KIT2
Plasmid#118984PurposeMutational dissection of the G rich region of the c-kit promoterDepositorAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pC-KIT4
Plasmid#118986PurposeMutational dissection of the G rich region of the c-kit promoterDepositorAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pC-KIT6
Plasmid#118988PurposeMutational dissection of the G rich region of the c-kit promoterDepositorAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_KIT
Plasmid#183306PurposeAll-in-One CRISPRko system with a guide RNA that targets KIT geneDepositorInsertKIT
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pC-KIT3
Plasmid#118985PurposeMutational dissection of the G rich region of the c-kit promoterDepositorAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pC-KIT7
Plasmid#118989PurposeMutational dissection of the G rich region of the c-kit promoterDepositorAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
SI14-Kit b
Plasmid#46304DepositorAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCS2-zfKitlgb
Plasmid#168200PurposeExpress zebrafish Kitlgb, mRNA synthesisDepositorInsertKitlgb (kitlgb Zebrafish)
UseVertebrate expression (zebrafish, chicken, xenopu…ExpressionMammalianMutationI85V, V222I, and D233N- please see depositor comm…Available SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSrTA1662-toolkit
Plasmid#154372PurposeExpresses SrTA1662 in plantsDepositorInsertSrTA1662
ExpressionBacterial and PlantPromoterNative promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-zfKitlga
Plasmid#168199PurposeExpress zebrafish Kitlga, mRNA synthesisDepositorInsertKitlga (kitlga Zebrafish)
UseVertebrate expression (zebrafish, chicken, xenopu…ExpressionMammalianMutationF198L - please see depositor commentsAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-gRNA:kit-1
Plasmid#60969PurposeExpression vector of rat Kit-1 guide RNADepositorInsertv-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Kit Rat)
UseCRISPRAvailable SinceJan. 5, 2015AvailabilityAcademic Institutions and Nonprofits only