We narrowed to 14,335 results for: Ung;
-
Plasmid#136009PurposeS149A G3BP1 inserted with MS2BP tagged on the N-terminus to use with the Tethering Assay (MS2)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only
-
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-1-147
Plasmid#136020PurposeEIF3B (1-147) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-148-464
Plasmid#136021PurposeEIF3B (148-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-465-552
Plasmid#136022PurposeEIF3B (465-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-1-464
Plasmid#136023PurposeEIF3B (1-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-148-552
Plasmid#136024PurposeEIF3B (148-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-Unstructured
Plasmid#136026PurposeEIF3B 3'UTR with the Artificial Unstructured 3'UTR fused downstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-Unstructured-EIF3B
Plasmid#136027PurposeEIF3B 3'UTR with the Artificial Unstructured 3'UTR fused upstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDSM-de-Phhf2-PYC-Tadh1
Plasmid#127737PurposeYeast pathway position 5. PYC transcription unit with the HHF2 promoter and ADH1 terminator.DepositorInsertpyruvate carboxylase (PYC1 Synthetic, Budding Yeast)
UseSynthetic BiologyExpressionYeastPromoterPhhf2Available SinceAug. 23, 2019AvailabilityAcademic Institutions and Nonprofits only