We narrowed to 18,224 results for: 110
-
Plasmid#110602PurposeBTK assembled plasmid- broad-host-range GFP expression from PA1 promoter (ampicillin resistance)DepositorInsertGFP
UseSynthetic BiologyAvailable SinceFeb. 14, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
EFS-GFP
Plasmid#110834Purposepositive control for GFP expressionDepositorInsertelongation factor 1alpha binding sequence (EFS) at GFP promoter region
UseLentiviralExpressionMammalianAvailable SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO/Flag-mKO2
Plasmid#110371PurposeMammalian expression of mKO2 with FLAG tag, Flp-In T-Rex systemDepositorInsertmonomeric Kusabira Orange 2
TagsFLAGExpressionMammalianPromoterCMVAvailable SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pB-CAGGS-dCas9-KRAB
Plasmid#110822PurposePiggyBac compatible plasmid expressing dCas9-KRABDepositorInsertdCas9-KRAB
ExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…PromoterCAGGSAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Leo1
Plasmid#11061DepositorInsertLeo1 (LEO1 Human)
ExpressionMammalianAvailable SinceDec. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HF1-P2A-GFP-PGK-Puro
Plasmid#110863PurposeLentiviral vector for constitutive expression of Cas9-HF1-P2A-GFP (not codon optimized)DepositorInsertCas9-HF1
UseLentiviralTags3X FLAGMutationN497A, R661A, Q695A, Q926APromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDUET-1-alpha-synuclein-mCerulean3-His6
Plasmid#110061PurposeFor bacterial expression of human alpha-synuclein, carboxyl terminally tagged with mCerulean3 and poly-histidinesDepositorAvailable SinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330.puro
Plasmid#110403PurposeCRISPR/Cas9 vector with sgRNA expression and puromycin resistanceDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCBhAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFLAG_attP
Plasmid#110095PurposeVector for low-level constitutive expression in mycobacteria from the Tet promoter. Lacks the Tet repressor. Contains attP for chromosomal integration. Lacks the integrase and thus remains stably integrated in the absence of antibiotic selection. Contains a C-terminal 3xFLAG to allow detection of expression levels by Western blotting.DepositorTypeEmpty backboneTags3xFLAGExpressionBacterialAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Paf1
Plasmid#11059DepositorInsertPaf1 (PAF1 Human)
ExpressionMammalianAvailable SinceDec. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 HRPT2
Plasmid#11048DepositorAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
hCD4-mOrange
Plasmid#110192PurposeEncodes for human CD4 coding sequence tagged with the mOrange FPDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Rtf1
Plasmid#11060DepositorInsertRtf1 (RTF1 Human)
ExpressionMammalianAvailable SinceDec. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pJM230 (pUC18T-miniTn7T-gm-rhaSR-PrhaBAD-stRBS-lacZ)
Plasmid#110560PurposeminiTn7 delivery plasmid with rhaSR-PrhaBAD inducible promoter and StRBS-lacZ insertDepositorInsertstRBS-lacZ
ExpressionBacterialPromoterrhaSR-PrhaBADAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMA_Int
Plasmid#110096PurposeE. coli replicative vector which contains the mycophage integrase gene required for the attP/attB integration. Is co-transformed in trans together with pFLAG_attP, but cannot replicate in mycobacteria, and is thus lost shortly after electroporation.DepositorInsertmycophage integrase
UseRequired for transformation of attb integrating v…Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ultra-Exon1Q145-Myc-A
Plasmid#110487PurposeLentiviral vector to express mutant N terminal HTT gene with short 3'UTR in mammalian cells (encodes Myc-tagged mutant huntingtin exon1 fragment with 145 repeats of Q)DepositorInsertHomo sapiens huntingtin (HTT Human)
UseLentiviralTagsMycExpressionMammalianMutationPartial long 3'UTR wild type huntingtin exon…PromoterUbCAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ultra-Exon1Q23-Myc-A
Plasmid#110486PurposeLentiviral vector to express wild-type N terminal HTT gene with short 3'UTR in mammalian cells (encodes Myc-tagged wild type huntingtin exon1 fragment with 23 repeats of Q)DepositorInsertHomo sapiens huntingtin (HTT Human)
UseLentiviralTagsMycExpressionMammalianMutationShort 3'UTR wild type huntingtin exon1 fragm…PromoterUbCAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCK306
Plasmid#110544PurposerhaBAD, a rhamnose-inducible promoter, YFP, an E. coli-Synechocystis shuttle vector, chromosomal-integration sites. Allows precise & sustained gene expression in cyanobacteria.DepositorInsertsPrhaBAD
yfp
rhaS
ExpressionBacterialPromoterN/A, PrhaBAD, and kanR promoter (upstream of kanR…Available SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDEST-HisMBP
Plasmid#11085DepositorHas ServiceCloning Grade DNATypeEmpty backboneTags6xHis and MBPExpressionBacterialPromoterTac (lactose/IPTG inducible)Available SinceFeb. 14, 2006AvailabilityAcademic Institutions and Nonprofits only