We narrowed to 258 results for: Cyanobacteria
-
Plasmid#165583PurposeExpresses mNeonGreen and C-terminally fused PDTDepositorInsertmNeonGreen-PDT
TagsProtein degradation tagExpressionBacterialPromoterPtrcAvailable sinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
EB2316
Plasmid#87753PurposepkaiBC::EYFP cloned between XbaI and XhoI of EB2065DepositorInsertpkaiBC::EYFP
Available sinceApril 20, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCJ111
Plasmid#175052PurposerbcLXS7002 integrative plasmid expresses CRE recombinase as a translational fusion to rbcLDepositorInsertCRE
UseUnspecifiedPromoterrbcLXSAvailable sinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMD19T-psba1-TetR-PL22-dCas9-SpR
Plasmid#73223PurposeContains dCas9 from S. pyogenes under aTc inducible promoter. Suicide vector inserts into psba1 site of Synechocystis. Carries spectinomycin resist. Recommend E. coli Copy cutter for propogation.DepositorPublicationInsertdCas9 from S. pyogenes
Tagsc-mycExpressionBacterialMutationSilent mutation at bp 1341 A->C to remove an E…PromoterPL22Available sinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSHDY-PL03-mVenus_tetR
Plasmid#137663PurposeConjugative vector derived from pSHDY. Constitutive expression of the repressor tetR, as well as aTc-inducible expression of mVenus.DepositorInsertPL03:mVenus
ExpressionBacterialPromoterPL03Available sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAM2314-RbcS-mNG
Plasmid#165582PurposeCyanobacterial carboxysome reporter with mNeonGreen driven by native rbcS promoterDepositorInsertmNeonGreen
ExpressionBacterialPromoterPrbcsAvailable sinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZD-CJ1111
Plasmid#175058PurposerbcLXS6803 integrative plasmid expresses CRE recombinase as a translational fusion to rbcL6803DepositorInsertCRE
UseUnspecifiedPromoterrbcLXSAvailable sinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
EB2317
Plasmid#87754PurposetetR-mTurqoise2 cloned between BamHI and EcoRI of pAM2991DepositorInsertTetR-mTurq2
Available sinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
EB2315
Plasmid#87752PurposeBbbJ23119::EYFP cloned between XbaI and XhoI of EB2065DepositorInsertBbbJ23119::EYFP
Available sinceApril 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSHDY-PvanCC-mVenus_vanR
Plasmid#137664PurposeConjugative vector derived from pSHDY. Constitutive expression of the repressor vanR, as well as vanillate-inducible expression of mVenus.DepositorInsertPvanCC:mVenus
ExpressionBacterialPromoterPvanCCAvailable sinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMD19T-psba1-Ppsba2-dCas9-SpR
Plasmid#73220PurposeContains dCas9 from S. pyogenes under constitutive promoter. Suicide vector inserts into psba1 site of Synechocystis. Carries spectinomycin resist. Recommend E. coli Copy cutter for propogation.DepositorPublicationInsertdCas9 from S. pyogenes
Tagsc-mycExpressionBacterialMutationSilent mutation at bp 1341 A->C to remove an E…PromoterPpsbA2Available sinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEYN12-mflon
Plasmid#165581PurposeLon protease from Mesoplasma florumDepositorInsertlon protease
ExpressionBacterialPromoterPtrcAvailable sinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCcmO-StrepII-PDT
Plasmid#165584PurposeNative CcmO fusion with a StrepII tag and PDTDepositorInsertCcmO-PDT
TagsProtein degradation tagExpressionBacterialAvailable sinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCJ155
Plasmid#175054PurposepsbEFLJ integrative plasmid expresses CRE recombinase from the rbcL promoter uses zeocin to integrateDepositorInsertCRE
UseUnspecifiedPromoterrbcLXSAvailable sinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pStA0::ECK120015170
Plasmid#171879PurposeTerminator ECK120015170 in pStA0DepositorInsertTerminator ECK120015170
UseSynthetic BiologyMutationN/AAvailable sinceFeb. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable sinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pStA0::SPLc19-RBS21
Plasmid#171885PurposePromoter SPLc19 and RBSc21 in pStA0DepositorInsertPromoter SPLc19 and RBSc21
UseSynthetic BiologyMutationN/AAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pStA0::SPLc19-RBSc249
Plasmid#171904PurposePromoter SPLc19 and RBSc249 in pStA0DepositorInsertPromoter SPLc19 and RBSc249
UseSynthetic BiologyMutationN/AAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pStA0::SPLc25-RBSc123
Plasmid#171900PurposePromoter SPLc25 and RBSc123 in pStA0DepositorInsertPromoter SPLc25 and RBSc123
UseSynthetic BiologyMutationN/AAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pStA0::SPLc45-RBSc21
Plasmid#171887PurposePromoter SPLc45 and RBSc21 in pStA0DepositorInsertPromoter SPLc45 and RBSc21
UseSynthetic BiologyMutationN/AAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only