We narrowed to 19,823 results for: INO
-
Plasmid#222897PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 11S.DepositorInsertFKBP-GPA-20GS-NanoLuc11S
TagsMycExpressionMammalianPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2376-FKBP-GPA-20-114
Plasmid#222896PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114.DepositorInsertFKBP-GPA-20GS-NanoLuc11S
TagsMycExpressionMammalianPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2374-FRB-GPA-20-11S
Plasmid#222895PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 11S.DepositorInsertFRB-GPA-20GS-NanoLuc11S
TagsMycExpressionMammalianPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2373-FRB-GPA-20-114
Plasmid#222894PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114.DepositorInsertFRB-GPA-20GS-NanoLuc114
TagsMycExpressionMammalianPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2179-FRB-GPA-6-GFPS
Plasmid#222893PurposeBiosensor chain detecting rapamycin and responding with split GFP reconstitution. FRB ectodomain, human Glycophorin A (GPA) scaffold, 6 GS linker, split GFP fragment small.DepositorInsertFRB-GPA-6GS-GFPS
TagsMycExpressionMammalianPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2110-FKBP-GPA-20-114
Plasmid#222881PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114.DepositorInsertFKBP-GPA-20GS-NanoLuc114
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2108-FRB-GPA-20-114
Plasmid#222879PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114.DepositorInsertFRB-GPA-20GS-NanoLuc114
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2109-FRB-GPA-20-11S
Plasmid#222880PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 11S.DepositorInsertFRB-GPA-20GS-NanoLuc11S
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR101
Plasmid#185046PurposeJ23108(spel), pHP14 stability hairpin, strong RBS, L31p coding region with amino acids 2-8 deleted, trrnBDepositorInsertL31p
ExpressionBacterialMutationAmino acids 2-8 deleted of L31p coding regionAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR111
Plasmid#185047PurposeJ23108(spel), pHP14 stability hairpin, strong RBS, L31p coding region with last 8 amino acids deleted, trrnBDepositorInsertL31p
ExpressionBacterialMutationLast 8 amino acids deleted of L31p coding regionAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA181
Plasmid#216024PurposeFragmid fragment: (Cas protein) unmodified AsCas12a; not preferredDepositorHas ServiceCloning Grade DNAInsertCas12a_v1.1 [As]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA016
Plasmid#215927PurposeFragmid fragment: (guide cassette) guide expressionDepositorHas ServiceCloning Grade DNAInsertU6_v1; DR_v0 [EnAs]; BsmBI_v2; BsmBI_v3
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA048
Plasmid#216016PurposeFragmid fragment: (Cas protein) deactivated CasDepositorHas ServiceCloning Grade DNAInsertdCas12a (D908A)_v1.1 [EnAs]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDA_816
Plasmid#216098PurposeCRISPRa, EF1a-driven ALFA-dCas12a-VP64 (Cas only)DepositorInsertCas12a [EnAs]
UseCRISPR and Lentiviral; Assembled vectorAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV2_hSyn_NES-Caprola_05-mEGFP_WRPE-SV40
Plasmid#194689PurposehSyn1 driven expression of the calcium recorder Caprola_05 fused to mEGFP for neuronal expression through AAV transductionDepositorInsertCaprola_05-mEGFP
UseAAVTagsmEGFPPromoterhSyn1Available SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-51b(+)-Caprola_04
Plasmid#194665PurposeProtein production of the split HaloTag based calcium recorder Caprola_04 in bacteriaDepositorInsertCaprola_04
TagsHis-tag and Strep-tagExpressionBacterialPromoterT7Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-51b(+)-Caprola_06
Plasmid#194667PurposeProtein production of the split HaloTag based calcium recorder Caprola_06 in bacteriaDepositorInsertCaprola_06
TagsHis-tag and Strep-tagExpressionBacterialPromoterT7Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-51b(+)-Caprola_07
Plasmid#194668PurposeProtein production of the split HaloTag based calcium recorder Caprola_07 in bacteriaDepositorInsertCaprola_07
TagsHis-tag and Strep-tagExpressionBacterialPromoterT7Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-51b(+)-Caprola_08
Plasmid#194669PurposeProtein production of the split HaloTag based calcium recorder Caprola_08 in bacteriaDepositorInsertCaprola_08
TagsHis-tag and Strep-tagExpressionBacterialPromoterT7Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only