We narrowed to 9,464 results for: CAG
- 
  Plasmid#205176PurposeExpresses mCherry-FIREtag-DEVDG-MoA in mammalian cellsDepositorInsertmCherry-cagedFIREtag
ExpressionMammalianAvailable SinceSept. 7, 2023AvailabilityAcademic Institutions and Nonprofits only - 
  
pCR-U6-gRNA-miniCMV-TdTomato
Plasmid#192656PurposeA plasmid encoding miniCMV sgRNA and miniCMV-promoter-TdTomatoDepositorInsertTdTomato
ExpressionMammalianPromoterU6, miniCMVAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only - 
  
pG2
Plasmid#162603PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only - 
  
SS9_RNA
Plasmid#71656PurposeSS9-targeting gRNA for co-transformation with pSS9DepositorInsertSS9 gRNA
UseCRISPRExpressionBacterialPromoterJ23119Available SinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only - 
  
Level 1 P4 TaU6 guide acceptor
Plasmid#165600PurposeGoldenGate (MoClo) Level 1 Position 4 TaU6 guide acceptor plasmidInsertTaU6 promoter::LacZ::sgRNA scaffold
UseCRISPR and Synthetic Biology; Sgrna acceptor with…Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only - 
  
Level 1 P3 TaU6 guide acceptor
Plasmid#165599PurposeGoldenGate (MoClo) Level 1 Position 3 TaU6 guide acceptor plasmidInsertTaU6 promoter::LacZ::sgRNA scaffold
UseCRISPR and Synthetic Biology; Sgrna acceptor with…Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only - 
  
pLKO.1 Rheb1 shRNA #1
Plasmid#26625DepositorAvailable SinceOct. 22, 2010AvailabilityAcademic Institutions and Nonprofits only - 
  
HaloKu70 sgRNA
Plasmid#207583PurposesgRNA for the insert of the HaloTag at the endogenous loci of Ku70.DepositorInsertGAGCAGTAGCCAACATGTCA
ExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only - 
  
LC3B sgRNA
Plasmid#207556PurposepX330 expressing Cas9 and a sgRNA targeting the LC3B locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only - 
  
pCR-Hyg
Plasmid#158708PurposeFor cloning and constitutive expression of crRNAs in mycobacteriumDepositorInsertcrRNA
UseCRISPR and Synthetic Biology; Mycobacteria expres…ExpressionBacterialPromoterHsp60Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only - 
  
pCR8-attL5-pegRNA-attR3
Plasmid#213054PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL5 and attR3DepositorInsertsgRNA
ExpressionBacterialAvailable SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only - 
  
WNK2 WT
Plasmid#24569DepositorAvailable SinceMay 20, 2010AvailabilityAcademic Institutions and Nonprofits only - 
  
pEX128·gRNA
Plasmid#187600PurposeTemplate for amplification of gRNA with Cas6 recognition siteDepositorInsertgRNA template
Promoterno promoterAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only - 
  
pCR8-attR4-pegRNA-attR3
Plasmid#213056PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attR4 and attR3DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only - 
  
pCR8-attL5-pegRNA-attL4
Plasmid#213055PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL5 and attL4DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only - 
  
pCR8-attL1-pegRNA-attR5
Plasmid#213053PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL1 and attR5DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only - 
  
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only - 
  
OA-1067B
Plasmid#200252PurposepBac-U6-gRNA(doublesex)-3xp3-tdTomatoDepositorInsert4 gRNAs targeting Doublesex
ExpressionInsectAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only - 
  
pX459_gRNA-AAVS1_hspCas9
Plasmid#193309PurposeCas9 from S. pyogenes and U6 AAVS1 sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6 AAVS1 sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only - 
  
ATG9A sgRNA
Plasmid#207557PurposepX330 expressing Cas9 and a sgRNA targeting the ATG9A locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only