We narrowed to 7,104 results for: tet on
-
Plasmid#171845PurposeC. elegans mex-5 promoter (germline) driven dual fluorescent reporter for boxB tethering (eGFP) with boxB negative control (mCherry)DepositorInserthis-58, eGFP, mCherry
UseTagsN-terminal Tag OLLAS, V5 and C-terminal Tag PEST…ExpressionWormMutationboxB wild type and hairpin mutantPromotermex-5 promoterAvailable sinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133D2.0
Plasmid#99894PurposeGolden Gate entry vector to express the 3rd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under OsU3 promoterDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterOsU3Available sinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131D2.0
Plasmid#100044PurposeGolden Gate entry vector to express the 1st gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under OsU3 promoterDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterOsU3Available sinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSW002-Pc-TorT(sp)
Plasmid#111255PurposeBroad host-range bacterial expression vector with constitutive Pc promoter followed by the E. coli TorT signal peptideDepositorInsertTorT signal peptide
UseTagsExpressionBacterialMutationPromoterPcAvailable sinceJuly 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralTagsExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCD5-ss-D/bovine/France/5920/2014-HEFwtED-GCN4-sfGFP-ST
Plasmid#175017PurposeExpresses influenza D virus trimeric hemagglutinin esterase fusion protein fused to a sfGFPDepositorInsertOK-HEFwtED
UseTagsGCN4-TEV-sfGFP-TwinStrepExpressionMammalianMutationPromoterCMVAvailable sinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTPTP alpha (S204A)
Plasmid#17694DepositorInsertPTPalpha S204A (PTPRA Human)
UseTagsHAExpressionMammalianMutationS204APromoterAvailable sinceApril 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
p5A1-Ti
Plasmid#92018PurposeExpresses TALE targeted to lac operator with 3 TEV cut sites in its repeat domain, anhydrotetracycline inducible catalytically inactive TEV proteaseDepositorInsertsTALE targeting lac operator with 3 TEV cleavage sites
Catalytically Inactive TEV Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…ExpressionMutationS219V, C151APromoterAvailable sinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZS1[LacI-L]
Plasmid#60745PurposeContains PI driving expression dimeric LacI, the Lactose inducible repressor.DepositorInsertLacI
UseSynthetic BiologyTagsExpressionBacterialMutationwt LacI without the tetramerization domainPromoterAvailable sinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
p5A7-T
Plasmid#92020PurposeExpresses TALE targeted to lac operator with one TEV cut site in its N-terminal domain and a second in the C-terminal domain, anhydrotetracycline inducible TEV proteaseDepositorInsertsTALE targeting lac operator with N and C-terminal TEV protease cleavage sites
Tobacco Etch Virus Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…ExpressionMutationS219VPromoterAvailable sinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
p5A3-T
Plasmid#92019PurposeExpresses TALE targeted to lac operator with one TEV cut site in its N-terminal domain, anhydrotetracycline inducible TEV proteaseDepositorInsertsTALE targeting lac operator with N-terminal TEV cleavage site
Tobacco Etch Virus Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…ExpressionMutationS219VPromoterAvailable sinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHL600
Plasmid#37563DepositorUseSynthetic BiologyTagsExpressionBacterialMutationPromoterpLlacO-1 and pLtetO-1Available sinceAug. 14, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV CaMKII:RiboL1-jGCaMP8m
Plasmid#239668PurposeExpresses soma-targeted (ribosome tethered via RiboL1) jGCaMP8m under CaMKII promoter.DepositorInsertRiboL1-jGCaMP8m
UseAAVTags6xHis and RiboL1ExpressionMammalianMutationPromoterCaMKIIAvailable sinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV CaMKII:RiboL1-jGCaMP8s
Plasmid#239667PurposeExpresses soma-targeted (ribosome tethered via RiboL1) jGCaMP8s under CaMKII promoter.DepositorInsertRiboL1-jGCaMP8s
UseAAVTags6xHis and RiboL1ExpressionMammalianMutationPromoterCaMKIIAvailable sinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-IFIT5_K206R-VA
Plasmid#191224PurposeLentiviral expression of human IFIT5_K206R in mammalian cellsDepositorInsertinterferon-induced protein with tetratricopeptide repeats 5 (IFIT5 Human)
UseLentiviralTags3xFlag-TEVx2-6xHis-Strep x2 tag and VA tagExpressionMammalianMutationchanged Lysine 206 to Arginine (K206R)PromoterCMVAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-NFHΔ36-72
Plasmid#232060PurposeExpresses construct for surface tethering: R. norvegicus NFH tail domain lacking residues 36-72DepositorInsertNeurofilament-Heavy tail domain lacking residues 36-72
UseTags6xHisExpressionBacterialMutationadded N-terminal tryptophan and tyrosine, and cys…PromoterAvailable sinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-NFHΔ462-638
Plasmid#232061PurposeExpresses construct for surface tethering: R. norvegicus NFH tail domain lacking residues 462-638DepositorInsertNeurofilament-Heavy tail domain lacking residues 462-638
UseTags6xHisExpressionBacterialMutationadded N-terminal tryptophan and tyrosine, and cys…PromoterAvailable sinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-NFLtail
Plasmid#232055PurposeExpresses construct for surface tethering: R. norvegicus NFL tail domainDepositorInsertNeurofilament-Light tail domain
UseTags6xHisExpressionBacterialMutationcDNA codon-optimized for E. coli; added N-termina…PromoterT7Available sinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-NFMtail
Plasmid#232056PurposeExpresses construct for surface tethering: R. norvegicus NFM tail domainDepositorInsertNeurofilament-Medium tail domain
UseTags6xHis, thrombinExpressionBacterialMutationcDNA codon-optimized for E. coli; added N-termina…PromoterT7Available sinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-NFMshuf1
Plasmid#232058PurposeExpresses construct for surface tethering: R. norvegicus NFM tail domain with more evenly distributed charged residues, sequence 1DepositorInsertNeurofilament-Medium tail domain, charge shuffle 1
UseTags6xHis, thrombinExpressionBacterialMutationPromoterAvailable sinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only