We narrowed to 11,363 results for: ENA;
-
Plasmid#146217PurposeInsect Expression of DmTral-S13AI15AD30KT35ADepositorInsertDmTral-S13AI15AD30KT35A (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-S13AI15AR21A_E
Plasmid#146218PurposeInsect Expression of DmTral-S13AI15AR21ADepositorInsertDmTral-S13AI15AR21A (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-R21A_E
Plasmid#146220PurposeInsect Expression of DmTral-R21ADepositorInsertDmTral-R21A (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
mitoTALECD for_atp1_1333NC
Plasmid#186202PurposeFor genome editing (base editing) of Arabidopsis mitochondria, targeted C of RNA editing site of ATP1 by OTP87DepositorInsertsmitochondrial targeted TALE left hand with 1333N of Cytidine Deaminase (mitoTALECD)
mitochondrial targeted TALE right hand with 1333C of Cytidine Deaminase (mitoTALECD)
UseSynthetic Biology; Ti plasmid for plant transform…Available SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
KCC2 scFv [N1/12]
Plasmid#190520PurposeMammalian Expression of KCC2 scFV. Derived from hybridoma N1/12.DepositorInsertKCC2 (Rattus norvegicus) recombinant scFV (Slc12a5 Mouse)
TagsHA, Sortase, 6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
ZMYND8-2A-neo
Plasmid#190619PurposeLentiviral expression plasmid of human ZMYND8, neomycin selectionDepositorInsertZMYND8 (ZMYND8 Human)
UseLentiviralTags3xFlagExpressionMammalianMutationsynonymous mutation for sgRNA resistance at aa214…Available SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
mitoTALECD for_atp1_1333CN
Plasmid#186201PurposeFor genome editing (base editing) of Arabidopsis mitochondria, targeted C of RNA editing site of ATP1 by OTP87DepositorInsertsmitochondrial targeted TALE left hand with 1333C of Cytidine Deaminase (mitoTALECD)
mitochondrial targeted TALE right hand with 1333B of Cytidine Deaminase (mitoTALECD)
UseSynthetic Biology; Ti plasmid for plant transform…Available SinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-LSm-V5His6_B
Plasmid#145996PurposeInsect Expression of DmTral-LSmDepositorInsertDmTral-LSm (tral Fly)
ExpressionInsectMutationone silent mutation A198C compared to the sequenc…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-E23K_B
Plasmid#145982PurposeInsect Expression of DmTral-E23KDepositorInsertDmTral-E23K (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-LSm-E23K-V5His6_B
Plasmid#145983PurposeInsect Expression of DmTral-LSm-E23KDepositorInsertDmTral-LSm-E23K (tral Fly)
ExpressionInsectMutationone silent mutation A198C compared to the sequenc…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-LSm-R21E-V5His6_B
Plasmid#145984PurposeInsect Expression of DmTral-LSm-R21EDepositorInsertDmTral-LSm-R21E (tral Fly)
ExpressionInsectMutationone silent mutation A198C compared to the sequenc…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-LSm-V5His6_B
Plasmid#145986PurposeInsect Expression of DmTral-LSmDepositorInsertDmTral-LSm (tral Fly)
ExpressionInsectMutationone silent mutation A198C compared to the sequenc…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-R21E_B
Plasmid#145987PurposeInsect Expression of DmTral-R21EDepositorInsertDmTral-R21E (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-LSm-E23K-V5His6_B
Plasmid#145990PurposeInsect Expression of DmTral-LSm-E23KDepositorInsertDmTral-LSm-E23K (tral Fly)
ExpressionInsectMutationone silent mutation A198C compared to the sequenc…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-LSm-R21ER42EF44A-V5His6_B
Plasmid#145991PurposeInsect Expression of DmTral-LSm-R21ER42EF44ADepositorInsertDmTral-LSm-R21ER42EF44A (tral Fly)
ExpressionInsectMutationone silent mutation A198C compared to the sequenc…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-LSm-R21ES13AI15A-V5His6_B
Plasmid#145992PurposeInsect Expression of DmTral-LSm-R21ES13AI15ADepositorInsertDmTral-LSm-R21ES13AI15A (tral Fly)
ExpressionInsectMutationone silent mutation A198C compared to the sequenc…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-LSm-R21E-V5His6_B
Plasmid#145993PurposeInsect Expression of DmTral-LSm-R21EDepositorInsertDmTral-LSm-R21E (tral Fly)
ExpressionInsectMutationone silent mutation A198C compared to the sequenc…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-LSm-R42E-V5His6_B
Plasmid#145994PurposeInsect Expression of DmTral-LSm-R42EDepositorInsertDmTral-LSm-R42E (tral Fly)
ExpressionInsectMutationone silent mutation A198C compared to the sequenc…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral_97-543-V5His6_D
Plasmid#146128PurposeInsect Expression of DmTral_97-543DepositorInsertDmTral_97-543 (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only