We narrowed to 10,843 results for: aav
-
Plasmid#220645PurposeAiE2147m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP1962 - pAAV-AiE2591m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214592PurposeAiE2591m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1425 - pAAV-AiE2132m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214495PurposeAiE2132m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
1518_pAAV-U6-SA-eGFP-gRNA-HLP-SACas9-HA-OLLAS-spA
Plasmid#109316PurposePlasmid for liver-specific expression of AAV SaCas9 with a gRNA against eGFPDepositorInserteGFP gRNA
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
AiP1078-pAAV-mscRE16-minBGpromoter-oNigri-WPRE-hGHpA
Plasmid#163490PurposeDirect-expressing oNigri AAV Virus. Alias: AiP1078 - pAAV-AiE2016m-minBG-oNigri-WPRE-HGHpADepositorInsertoNigri
UseAAVPromoterBeta Globin minimal promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-DIO ChRmine-oScarlet-KV 2.1-WPRE
Plasmid#183536PurposeOptogeneticsDepositorInsertChRmine-oScarlet-Kv2.1
UseAAVMutationNonePromoterCaMKIIaAvailable SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
AiP14924 - pAAV-AiE0675m-minBG-iCre(297T)-BGHpA
Plasmid#233571PurposeAiE0675m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertiCre(R297T)
UseAAVAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-Flex-DN-AMPK-K45R-T2A-mCherry
Plasmid#83491Purposecre-dependent DN-AMPK under EF1a promoterDepositorInsertDN-AMPK-2A-mCherry
UseAAV and Cre/LoxExpressionMammalianMutationK45RAvailable SinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Fon-Arch3.3-p2a-EYFP
Plasmid#137148PurposeIntersectional viral expression of Arch3.3-EYFP in cells expressing both Cre AND FlpDepositorHas ServiceAAV8InsertCon/Fon-Arch3.3-p2a-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-ChRmine-eYFP-Kv2.1-WPRE
Plasmid#130997PurposeDouble floxed soma-targeted ChRmine-eYFP under the control of Ef1a promoterDepositorInsertChRmine
UseAAVTagsEYFP-Kv2.1PromoterEf1aAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIC3-scaffold (2xBsmBI sites)
Plasmid#120301PurposeAAV vector for expression of AcrIIC3 (no miR binding sites, control vector)DepositorInsertAcrIIC3
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
AiP1774 - pAAV-AiE2449m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214540PurposeAiE2449m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-ChR2-EYFP
Plasmid#137163PurposeIntersectional viral expression of ChR2-EYFP in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-ChR2-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationH134RPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
AiP1047-pAAV-mscRE16-minBGpromoter-iCre-WPRE-hGHpA
Plasmid#163479PurposeDirect-expressing iCre AAV Virus. Alias: AiP1047 - pAAV-AiE2016m-minBG-iCre-WPRE-HGHpADepositorInsertiCre
UseAAVPromoterBeta Globin minimal promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-GtACR2-P2A-Voltron2ST-W3SL
Plasmid#217676PurposeAAV-mediated, Cre-dependent co-expression of GtACR2 and soma-targeted Voltron2 (ORCHID) for assessing inhibitory receptor driving force through voltage imaging with concurrent activation of GtACR2.DepositorHas ServiceAAV1InsertGtACR2-P2A-Voltron2ST
UseAAVTagsSoma targeting sequence (Kv2.1) on Voltron2 gene …ExpressionMammalianPromoterEF‐1αAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
AiP1894 - pAAV-AiE2582m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214573PurposeAiE2582m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
p226-AAV-dlx-dio-mScarlet-T2A-SYPEGFP
Plasmid#185696PurposeAAV vector expressing cre-dependent mem-mScarlet, T2A, Synaptophysin-EGFP driven by Dlx promoterDepositorInsertmScarlet, T2A, Synaptophysin-EGFP
UseAAV and Cre/LoxTagsmScarlet palmitoylation, Synaptophysin fused to E…ExpressionMammalianPromotermDlxAvailable SinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
AiP995-pAAV-mscRE10-minBGpromoter-EGFP-WPRE-hGHpA
Plasmid#163485PurposeDirect-expressing EGFP AAV Virus. Alias: AiP995 - pAAV-AiE2010m-minBG-EGFP-WPRE-HGHpADepositorInsertEGFP
UseAAVPromoterBeta Globin minimal promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Camk2a(0.4)-DIO-Opto-cytTrkB(E281A)-HA
Plasmid#180588PurposeOpto-cytTrkBDepositorInsertTrkB
UseAAVMutationPHR(E281A)Available SinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only