We narrowed to 3,364 results for: guide rna expression plasmid
-
Plasmid#200640PurposeAn. gambiae transgenesis plasmid. Expresses gRNAs targeting B2-tubulin, ZPG, and DSXF. Crossing to Cas9 generates sterile malesDepositorInsertgRNA targeting DSXF, ZPG, and B2-tubulin. Actin5c-CFP and Vasa2-EYFP reporters.
UseCRISPRExpressionInsectAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-enCas9-PolI5M
Plasmid#113078PurposeExpresses enCas9 fused to PolI5M in E. coli. contains a BsmbI-flanked GFP cassette for sgRNA cloning.DepositorInsertenCas9-PolI5M
UseCRISPRExpressionBacterialAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-enCas9-PolI3M-TBD
Plasmid#113077PurposeExpresses enCas9 fused to PolI3M-TBD in E. coli. contains a BsmbI-flanked GFP cassette for sgRNA cloning.DepositorInsertenCas9-PolI3M-TBD
ExpressionBacterialAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
EF1a-tagBFP-bGH
Plasmid#235257PurposetagBFP expression to serve as a "filler" plasmid for transfectionsDepositorInserttagBFP
UseSynthetic BiologyExpressionMammalianMutationSilent mutations to remove BsaI sites in tagBFPPromoterEF1a (human EF1a)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEG302-SunTagng-22aa
Plasmid#115345PurposeEncodes a SunTag CRISPR cas9 system that does not contain a guide RNA and therefore, does not target the TET1 catalytic domain to any specific region of the genomeDepositorInsertNOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgNT-2-EF1a-LibVec
Plasmid#239593Purposeexpresses non-targeting (NT) guide#2DepositorInsertNT (non-targeting guide)
UseAAV; To deliver a non-targeting guide (serving as…PromoterhU6Available SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgNT-1-EF1a-LibVec
Plasmid#239592Purposeexpresses non-targeting (NT) guide#1DepositorInsertNT (non-targeting guide)
UseAAV; To deliver a non-targeting guide (serving as…PromoterhU6Available SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only