Skip to main content

We narrowed to 9,310 results for: yeast expression

Showing: 6301 - 6320 of 9310 results
  1. pmr101A-cPr-mNeonGreen (KmR)

    Plasmid
    #177209
    Purpose
    Plasmid with p15A origin for constitutive mNeonGreen expression in E. coli
    Depositor
    Insert
    mNeonGreen
    Expression
    Bacterial
    Mutation
    Yeast codon optimized
    Promoter
    Synthetic constitutive promoter
    Available Since
    Nov. 23, 2021
    Availability
    Academic Institutions and Nonprofits only
  2. pmr101A-cPr-mNeonGreen (ErmR)

    Plasmid
    #177208
    Purpose
    Plasmid with p15A origin for constitutive mNeonGreen expression in E. coli
    Depositor
    Insert
    mNeonGreen
    Expression
    Bacterial
    Mutation
    Yeast codon optimized
    Promoter
    Synthetic constitutive promoter
    Available Since
    March 16, 2022
    Availability
    Academic Institutions and Nonprofits only
  3. pBHM2641

    Plasmid
    #229525
    Purpose
    Carries OsTIR1-t2a-mNG-AID*, used to insert TIR1 expressing construct into the C. neoformans genome.
    Depositor
    Insert
    OsTIR1
    Use
    CRISPR
    Tags
    t2a-mNeonGreen-AID*
    Expression
    Bacterial and Yeast
    Mutation
    F74G
    Promoter
    TEF1
    Available Since
    March 26, 2025
    Availability
    Academic Institutions and Nonprofits only
  4. pBHM2647

    Plasmid
    #229989
    Purpose
    Carries OsTIR1-t2a-mNG-mIAA7, used to insert TIR1 expressing construct into the C. neoformans genome.
    Depositor
    Insert
    OsTIR1
    Tags
    t2a-mNeonGreen-mIAA7_opt
    Expression
    Bacterial and Yeast
    Mutation
    F74G
    Available Since
    March 26, 2025
    Availability
    Academic Institutions and Nonprofits only
  5. pBHM2648

    Plasmid
    #229990
    Purpose
    Carries OsTIR1-t2a-mNG-mIAA7, used to insert TIR1 expressing construct into the C. neoformans genome.
    Depositor
    Insert
    OsTIR1
    Tags
    t2a-mNeonGreen-mIAA7_opt
    Expression
    Bacterial and Yeast
    Mutation
    F74G
    Available Since
    March 26, 2025
    Availability
    Academic Institutions and Nonprofits only
  6. pBHM2649

    Plasmid
    #229991
    Purpose
    Carries OsTIR1-t2a-mNG-mIAA7, used to insert TIR1 expressing construct into the C. neoformans genome.
    Depositor
    Insert
    OsTIR1
    Tags
    t2a-mNeonGreen-mIAA7_opt
    Expression
    Bacterial and Yeast
    Mutation
    F74G
    Available Since
    March 26, 2025
    Availability
    Academic Institutions and Nonprofits only
  7. pAG426-GAL-Kar2-Beta-Amyloid

    Plasmid
    #181707
    Purpose
    Galactose inducible expression of Kar2-Beta-Amyloid
    Depositor
    Insert
    Kar2-Beta-Amyloid
    Expression
    Yeast
    Available Since
    April 24, 2024
    Availability
    Academic Institutions and Nonprofits only
  8. pGR595

    Plasmid
    #213785
    Purpose
    Integrates at the CAN1 locus the BadBoy2 TP-DNAP1 variant and the Nourseothricin resistance marker. Includes an I-SceI transient expression cassette.
    Depositor
    Insert
    BadBoy2 TP-DNAP1
    Use
    Synthetic Biology
    Expression
    Yeast
    Available Since
    March 4, 2024
    Availability
    Academic Institutions and Nonprofits only
  9. YIp204-PADH1-AFB2

    Plasmid
    #99531
    Purpose
    S. cerevisiae expression of F-box protein AFB2 under control of the ADH1 promoter, TRP1 marker (for use with the AID degron system)
    Depositor
    Insert
    AFB2 (AFB2 Mustard Weed)
    Expression
    Yeast
    Promoter
    ADH1
    Available Since
    Sept. 14, 2017
    Availability
    Academic Institutions and Nonprofits only
  10. pRS303-PADH1-AFB2

    Plasmid
    #99530
    Purpose
    S. cerevisiae expression of F-box protein AFB2 under control of the ADH1 promoter, HIS3 marker (for use with the AID degron system)
    Depositor
    Insert
    AFB2 (AFB2 Mustard Weed)
    Expression
    Yeast
    Promoter
    ADH1
    Available Since
    Sept. 14, 2017
    Availability
    Academic Institutions and Nonprofits only
  11. pHflu4

    Plasmid
    #203882
    Purpose
    pHI1 with insertion of monomeric red fluorescent protein (mRFP)
    Depositor
    Insert
    monomeric red fluorescent protein
    Use
    Synthetic Biology
    Expression
    Bacterial and Yeast
    Available Since
    Dec. 6, 2023
    Availability
    Academic Institutions and Nonprofits only
  12. STK25

    Plasmid
    #39075
    Purpose
    Bacterial expression for structure determination; may not be full ORF
    Insert
    STK25 (STK25 Human)
    Tags
    His6-Zb-TEV
    Expression
    Bacterial
    Available Since
    March 18, 2013
    Availability
    Academic Institutions and Nonprofits only
  13. pAG426-GAL-TAF15

    Plasmid
    #181713
    Purpose
    Galactose inducible expression of TAF15
    Depositor
    Insert
    TAF15 (TAF15 Human)
    Expression
    Yeast
    Available Since
    June 14, 2024
    Availability
    Academic Institutions and Nonprofits only
  14. pXP420 v2 (repaired Amp promoter)

    Plasmid
    #86920
    Purpose
    Shuttle vector to facilitate gene expression for metabolic engineering in S. cerevisiae. Contains TEF1 promoter and CYC1 terminator for insertion of gene of interest. Contains HIS3 selection marker.
    Depositor
    Type
    Empty backbone
    Use
    Cre/Lox
    Expression
    Yeast
    Promoter
    TEF1
    Available Since
    Feb. 22, 2017
    Availability
    Academic Institutions and Nonprofits only
  15. pML104-HygMx4-URA3-3

    Plasmid
    #232886
    Purpose
    Plasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.
    Insert
    URA3 gRNA (URA3 Budding Yeast)
    Use
    CRISPR
    Expression
    Yeast
    Promoter
    snR52
    Available Since
    Feb. 26, 2025
    Availability
    Academic Institutions and Nonprofits only
Showing: 6301 - 6320 of 9310 results