We narrowed to 82,772 results for: TRI
-
Plasmid#123338PurposeMitochondria-targeted yellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertDAKAP-Venus-cpVenus-FLARE-AKAR
TagsN-terminal 30 amino acids from DAKAP1, Venus, and…ExpressionMammalianPromoterCMVAvailable SinceJuly 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-Ma-sfGFP WT
Plasmid#197567PurposeExpression of sfGFP WT with Methanomethylophilus alvus (Ma) Pyl-tRNA for the encoding of non-canonical amino acids at TAG codons in HEK293 cellsDepositorInsertssfGFP WT
M. alvus Pyl-tRNA (6) (4x copies)
TagsV5-His6ExpressionMammalianPromoterCMV and U6/H1Available SinceApril 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO-miR-124-sponge (pos. CTRL)
Plasmid#117327PurposeDual luciferase assay positive control for miR-124 bindingDepositorInsertmiR-124 sponge
UseLuciferaseTagsluciferaseExpressionMammalianPromoterMurine PGK-1Available SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNUT N6His K206E/K534A hTFNG
Plasmid#70133PurposeExpresses N-His tagged nonglycosylated human serum transferrin unable to release iron from the N-lobe or the C-lobeDepositorInsertN6His K206e/K534A hTFNG (TF Human)
TagsN-terminal signal peptide, 4 aa link, 6 His, Fact…ExpressionMammalianMutationchanged Lys206 to a glutamic acid and Lys534 to a…PromoterSV40Available SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO-miR-124-sponge_rev(neg. CTRL)
Plasmid#117326PurposeDual luciferase assay negative control for miR-124 bindingDepositorInsertreverse miR-124 sponge
UseLuciferaseTagsluciferaseExpressionMammalianPromoterMurine PGK-1Available SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CreLite
Plasmid#131785PurposeAAV donor/transfer vector expressing CreLite system components, PhyBΔCreC and PIF6CreN, driven by CBh promoterDepositorInsertPhyBCreC-P2A-PIF6CreN
UseAAV, Cre/Lox, and Synthetic BiologyExpressionMammalianPromoterCBhAvailable SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMT-myl7-cytoBirA-2A-mCherry_Ras
Plasmid#80060PurposeMyl7 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterMyl7 promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_mGFP-FGFR3-G380R
Plasmid#191755PurposeExpression of N-terminally mGFP labelled mutated FGFR3 (isoform IIIc)-G380R mutation (associated with ACH; target mutation: c.1138G>A; silent mutation added on purpose: c.1131C>T)DepositorInsertmGFP-FGFR3IIIc
TagsmGFPExpressionMammalianMutationc.1138G>A (G380R) + c.1131C>T (silent mutat…Available SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLJM1 Flag GFP 4E-BP1 Rheb15
Plasmid#112761Purposeexpress GFP-4EBP1-Rheb15DepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIRESpuro-Flag-Pol b(K72A)
Plasmid#23258DepositorAvailable SinceMarch 31, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Venus-cpVenus-FLARE-EKAR-EV
Plasmid#123339PurposeYellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring ERK activity. Contains monomeric Venus/cpVenus-E172 homoFRET pair.DepositorInsertVenus-cpVenus-FLARE-EKAR-EV
Tags6xHIS, T7 tag (gene 10 leader), Venus, Xpress (TM…ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX 4t1 RARalpha (1-187)
Plasmid#35558DepositorAvailable SinceApril 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
pPKm-230
Plasmid#90499PurposepSIN - EF-1alpha - PIF3 - MTAD - IRES - PhyB - GBD, dual vector of PIF3-MTAD under EF-1 alpha promoter and PhyB-DBD under IRES promoter; See growth conditions below.DepositorInsertmito-tFD and mito-tFNR
UseLentiviralAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIRESneo-MPG(N169D)
Plasmid#23259DepositorAvailable SinceMarch 31, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hGRM1-RFP
Plasmid#22920DepositorInserthuman receptor metabotropic 1 promoter driving DsRedExpress (GRM1 Human)
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mA93-RFP
Plasmid#22918DepositorInsertmouse riken gene A930038C07Rik promoter driving DsRedExpress (A930038C07Rik Mouse)
UseAAVExpressionMammalianAvailable SinceAug. 26, 2010AvailabilityAcademic Institutions and Nonprofits only -
K15-TK/pGL3
Plasmid#44267DepositorInsertK15 promoter (-4.8) (Krt15 Mouse)
UseMouse Targeting; Thymidine kinaseTagsHSV-1 TKExpressionMammalianMutationContains the murine K15 promoter (-4.8) fragmentPromotermurine K15 promoter (-4.8) fragmentAvailable SinceApril 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMT-zic2a-cytoBirA-2A-mCherry_Ras
Plasmid#80064PurposeZic2a promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterZic2a enhancer driving c-fos promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMT-ubb-NLS-BirA-2a-mCherry
Plasmid#79886PurposeUbiquitin promoter driving HA-tagged biotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein; flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
Tags3x HAExpressionBacterialPromoterUbiquitinAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only