We narrowed to 25,670 results for: promoter
-
Plasmid#212164PurposeThis binary vector has an empty backbone where you can insert a gene into a cassette with a strong promoter (truncated35sCAMV)DepositorTypeEmpty backboneExpressionPlantAvailable SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pSW027
Plasmid#201315PurposeUBI:fLUC (Firefly luciferase with Ubiquitin promoter)DepositorInsertfLUC
ExpressionPlantMutationremoval of BsaI and BpiI sitesPromoterpICSL12009Available SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIVTR(T7G)-PuroR
Plasmid#172290PurposeIn vitro transcription of Puro resistance gene (pac)DepositorInsertPuroR
UseOtherPromoterT7 promoter G-initiatingAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-CasRx-tagBFP-PGK-Blasticidin
Plasmid#187952PurposeFKBP12 (F36V mutant) degron-tagged CasRx fused with tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-CasRx-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linker, HA-tag, and NLSExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
Bin1 delta N-BAR
Plasmid#168282PurposeExpress N-BAR-deleted Bin1 mutant (aa 268-476)DepositorAvailable SinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
Bin1 N-BAR domain
Plasmid#168280PurposeExpress N-BAR domain of Bin1 (aa 1-267) in pEGFP-N1 vectorDepositorAvailable SinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
Bin1 delta SH3
Plasmid#168283PurposeExpress SH3-deleted Bin1 mutant (aa 1-404) in pEGFP-N1 vector.DepositorAvailable SinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLX307 P2A GFP Luciferase
Plasmid#193674PurposeConstitutive lentiviral expression of LuciferaseDepositorInsertLuciferase
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-Bi-gePSI-pCMV-AcGFP
Plasmid#131008PurposeExpresses both the gePSI-α-chain and the gePSI-β-chain under control of the inducible bi-directional TRE3G promoter. Expresses constitutively AcGFP under control of a CMV promoter.DepositorInsertsgePSI-β-chain
gePSI-α-chain
AcGFP1
UseAAVTagsmurine ornithine decarboxylase - degron (ODC36)ExpressionMammalianPromoterpCMV and pTRE3G-BiAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDB6 (CK2alpha')
Plasmid#27084DepositorAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2
Plasmid#85208PurposeBackbone for lentiviral gene silencing with monomeric Kusabira-Orange2 expressionDepositorTypeEmpty backboneUseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZW12 (CK2beta)
Plasmid#27088DepositorAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pJR98
Plasmid#187239PurposeCR3 constant region - hU6 sgRNA promoter flanked by BsmBI sitesDepositorInsertCR3 constant region - hU6 sgRNA promoter flanked by BsmBI sites
ExpressionBacterialAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
vDip-C: pAAV-Pcp2-mGreenLantern-KASH
Plasmid#207613PurposevDip-C AAV vector with mouse Pcp2 (also known as L7) promoter driving green fluorophore mGreenLantern with a KASH nuclear membrane tag to isolate cell nuclei of cerebellar Purkinje cellsDepositorInsertmGreenLantern
UseAAVTagsKASHPromotermouse Pcp2 promoter (L7-6)Available SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3 GCN1-3xFlag_IRES-iRFP
Plasmid#198388PurposeGCN1 expressionDepositorAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ERT2-iCre-ERT2
Plasmid#178059PurposeConditionally active form of Cre recombinase (activated in response to tamoxifen) under Syn promoter.DepositorInsertERT2-iCre-ERT2
UseAAVExpressionMammalianPromoterHuman synapsin 1 (Syn) promoterAvailable SinceOct. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEF5B-FRT-GFP-αTAT1[D157N]
Plasmid#27100DepositorInsertαTubulin K40 acetyltransferase (ATAT1 Human)
TagsGFP and S-tagExpressionMammalianMutationD157NAvailable SinceJan. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pX333
Plasmid#64073PurposeVector for tandem expression of two sgRNAs from two independent U6 promoters. Cas9 is expressed by Cbh promoter.DepositorHas ServiceCloning Grade DNATypeEmpty backboneTags3XFLAG-Cas9ExpressionMammalianPromoterCBh; U6Available SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUAS:Cas9T2AGFP;U6:sgRNA1;U6:sgRNA2
Plasmid#74009PurposeTissue-specific knock-out in zebrafish, Cas9 and GFP driven by a UAS promoterDepositorInserts5x UAS
Cas9
T2A
GFP
U6 promoter
UseCRISPRAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only