We narrowed to 10,071 results for: CAG
-
Plasmid#138989PurposeIVT template for the alpha subunit of the mouse TCR #33 that is reactive against MC38DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTCRA (Tcra Mouse)
ExpressionMammalianPromoterCMV and T7Available sinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
PRKAR1A gRNA (BRDN0001146329)
Plasmid#77720Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAR1ADepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA2 gRNA (BRDN0001147334)
Plasmid#75732Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA2DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPPC010.AAV
Plasmid#171175PurposeExpression of Sp.pCas9-dCas9, BBa_J23107-MCP-SoxS(R93A/S101A), and hAAVS1 scRNA on pBBR1-KmR plasmidDepositorInsertshAAVS1 scRNA
Sp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPRExpressionBacterialMutationSoxS has R93A and S101A mutationsPromoterBBa_J23119 and Sp.pCas9, BBa_J23107Available sinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
LADL Bridge + Target Zfp462-Klf4SE
Plasmid#127668PurposeEncodes for CRY2-HA and mCherry proteins expressed from the EF1a promoter; 2 gRNAs targeting the Zfp462 promoter and 2 gRNAs targeting the Klf4 SE expressed from their individual hU6 promotersDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCRY2-HA-2A-mCherry and gRNAs 129, 135, 115 and 117
UseCRISPRTagsHAExpressionMammalianPromoterEF1a and hU6Available sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
B270 + SPRTN sgSTOP
Plasmid#100718PurposeB270 plasmid expressing SPRTN sgSTOP (cloned in BbsI site) in combination with ATP1A1 sgSTOPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgSTOP targeting SPRTN (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable sinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + TIMELESS sgSTOP
Plasmid#100713PurposeB52 plasmid expressing TIMELESS sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgSTOP targeting TIMELESS (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable sinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
MAPK14 gRNA (BRDN0001148417)
Plasmid#77924Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK14DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TGFBR2 gRNA (BRDN0001148563)
Plasmid#77467Purpose3rd generation lentiviral gRNA plasmid targeting human TGFBR2DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAPK9 gRNA (BRDN0001147698)
Plasmid#76718Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK9DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOPTXcGMPRELUC
Plasmid#68503Purposecyclic nucleotide reporter for bacteria or plant cellsDepositorInsertOPTX promoter with cGMPRE (AT1G33440 Mustard Weed)
TagsluciferaseExpressionBacterial and PlantMutation3x cGMPRE inserted 190bp 5' of ATG (cGMPRE =…PromoterOPTX promoter with cGMPREAvailable sinceSept. 3, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
shERK2b-mlpx-neo
Plasmid#65231Purposeencodes a shRNA against ERK2DepositorAvailable sinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-beta2 RD-1-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128343PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertChrnb2 (Chrnb2 Mouse)
UseCRISPRExpressionMammalianAvailable sinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pFlare9A-Clip2E9 Mutant
Plasmid#209575Purposeminigene construct for Clip2 E9 alternative splicing, potential PTBP2 binding sites are deletedDepositorInsertClip2 (Clip2 Mouse)
ExpressionMammalianMutationACGCGTTTCTGAATTCTTCTAACTGCCCTCAAATGCACGGTGGCATGTG…PromoterCMVAvailable sinceMarch 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Otx2 x2)
Plasmid#171102PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Otx2.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthSpCas9 (Otx2 Mouse, S. pyogenes)
UseCRISPRPromoterEf1aAvailable sinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 ATP5O(TISU)-FF
Plasmid#85489PurposeFirefly luciferase under the control of ATP5O TISUDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFull TISU element of ATP5O (ATP5PO Human)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutation2nd and 3rd codon of luciferase were modified fro…Available sinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Satb2 sesRNA-2a-msFlag-2a-tTA-WPRE
Plasmid#239028PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1a_HH-HEK3 spacer-gRNA scaffold-EC73-5'-donor template-EC73-3'-HDV_pA_pCMV_EGFP-L138S-P2A-mCherry_pA
Plasmid#176460PurposeVector for expressing retron Ec73ncRNA-gRNA chimeric RNA (rgRNA) targeting HEK3 site driven by EF1alpha promoter and EGFP(L138S)-P2A-mCherry driven by CMVDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHH-HEK3 spacer-gRNA scaffold-Ec73ncRNA-donor sequence-HDV
UseCRISPRExpressionMammalianPromoterEF1alphaAvailable sinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only