We narrowed to 16,291 results for: grna
-
-
-
-
TLCV2 sgAAVS1
Plasmid#127099PurposeEncodes gRNA for human AAVS1.DepositorAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_NQO1
Plasmid#214684PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human NQO1DepositorInsertdgRNA_NQO1 (NQO1 Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUbi-RZ-Lb
Plasmid#86197PurposeLbCpf1 Gateway gRNA entry plasmid using Zea mays Ubi promoter and ribozyme processingDepositorInsertgRNA cloning site
UseCRISPRPromoterMaize ubiquitin 1Available SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pLV-U6-UL29-egfp-U3-UL8
Plasmid#166694PurposeTo express gRNA expression cassette simultaneously targeting two genes: UL8 and UL29 (EGFP version).DepositorAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
-
Direct-seq_lentiGuide-Puro-tRNA-Loop2-8A8G
Plasmid#157986PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (tRNA-Loop2-8A8G)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Direct-seq_lentiGuide-Puro-Loop2-8A8G
Plasmid#157983PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (Loop2-8A8G)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
