We narrowed to 7,057 results for: crispr cas9 plasmids
-
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCyCBE
Plasmid#226505PurposeA cytidine deaminase-mediated base-editing plasmid in cyanobacteriaDepositorInsertsAPOBEC1-Cas9D10A
sgRNA
sacB gene
UseCRISPRAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIVT-ABE-DEN2
Plasmid#238020Purposefor DNA-free adenine base editing in rice and wheat or other plantsDepositorInsertTadA8e-nSpCas9(D10A)
ExpressionPlantMutationD10A for SpCas9PromoterT7Available SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIVT-ABE-TMV
Plasmid#238021Purposefor DNA-free adenine base editing in rice and wheat or other plantsDepositorInsertTadA8e-nSpCas9(D10A)
ExpressionPlantMutationD10A for SpCas9PromoterT7Available SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIVT-A3A-DEN2
Plasmid#238019Purposefor DNA-free cytosine base editing in rice and wheat or other plantsDepositorInsertA3A-nSpCas9(D10A)-UGI
ExpressionPlantMutationD10A for SpCas9PromoterT7Available SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-TurboCas-NLS-Blast
Plasmid#232346PurposeLentiviral expression vector for dCas9 fused to miniTurboNLSDepositorInsertdCas9
UseCRISPR and LentiviralTags3xHA, miniTurbo, V5 and 3xSV40 NLSExpressionMammalianPromoterEF1aAvailable SinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
scAAV-sgRNA-GFP
Plasmid#177935PurposeExpresses sgRNA and can be packaged into AAV particles for somatic delivery into Cas9 transgenic miceDepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianPromoterU6Available SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28b-Hf-RfxCas13d-His
Plasmid#234480PurposePlasmid for bacterial expression and purification of High-fidelity RfxCas13d protein (human codon-optimized)DepositorInsertRfxCas13d
UseCRISPRTags6xHisExpressionBacterialMutationChanged four alanine to valine in positions 134, …Available SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
P532_POU4F2-p2A-tdTomato-p2A-Thy1.2
Plasmid#239102PurposeHuman donor plasmid for integration of p2A-h2b-EGFP into the 3' end of POU4F2 (aka BRN3B). This includes the donor casette and a U6 driven guide sequence to be used with Cas9.DepositorInsertPOU4F2 (POU4F2 Human)
UseDonor plasmid for integration into the human geno…Tagsp2A-tdTomato-p2A-Thy1.2ExpressionMammalianPromoterEndogenous POU4F2Available SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
DBJS-p2.13
Plasmid#246892PurposeA human codon-optimized SpCas9 and chimeric guide RNA expression plasmid encoding guide for G3BP2 Nterm.DepositorInsertG3BP2 Nterm Guide RNA 1 (G3BP2 Human)
ExpressionMammalianAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_ACTB CRISPIE
Plasmid#172853PurposeActb sgRNA & DRS-2 sgRNA expression under U6. CRISPIE donor mEGFP phase (0-0), excised by DRS-1 or DRS-2 (with SpCas9). Also expresses mRuby3 under the CBA promotor. See Zhong et al, eLife 2021.DepositorInsertsActb intron 1 sgRNA
DRS-2 sgRNA
CRISPIE designer exon (phase 0-0) encoding mEGFP
mRuby3
UseAAV and CRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
MKC86_HBA1(tEPOR-2A-YFP)
Plasmid#232405PurposeAAV production plasmid for tEPOR-2A-YFP vector from Fig. 2 that mediates HDR at HBA1 locus using HBA1-sg4 gRNA. HBA1 UTRs flank full tEPOR-2A-YFP cassette. Homology arms mediate full HBA1 replacement.DepositorUseAAVExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
TS-PE2-C-WPRE
Plasmid#176650PurposeExpresses C-terminus of PE2 in mammalian cellsDepositorInsertsC-terminus of PE2
Artificial SA
WPRE
bGH poly(A)
UseAAVTagsSV40 NLSExpressionMammalianPromoterNoneAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only