We narrowed to 4,503 results for: chm
-
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA TR KO 2
Plasmid#207610PurposesgRNA 2 to knockout TR by replacement with a PuroR cassetteDepositorInsertTCAGGCCGCAGGAAGAGGAA
TagsNoneExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG13 sgRNA
Plasmid#207558PurposepX330 expressing Cas9 and a sgRNA targeting the ATG13 locusDepositorInsertggaaactgatctcaattccc
ExpressionMammalianPromoterCMV and U6Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA TR KO 1
Plasmid#207609PurposesgRNA 1 to knockout TR by replacement with a PuroR cassetteDepositorInsertACCCTAACTGAGAAGGGCGT
TagsNoneExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
OA-986C
Plasmid#125000PurposeExpresses dCas9-VPR driven by the bottleneck promoterDepositorInsertdCas9-VPR
UsePiggybackExpressionInsectPromoterbottleneckAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-986D
Plasmid#125001PurposeExpresses dCas9-VP64 driven by the Ubiquitin-63E promoterDepositorInsertdCas9-VP64
UsePiggybackExpressionInsectPromoterubiquitinAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-986E
Plasmid#125002PurposeExpresses dCas9-VP64 driven by the bottleneck promoterDepositorInsertdCas9-VP64
UsePiggybackExpressionInsectPromoterbottleneckAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050I (notch)
Plasmid#132421Purposeexpress arrays of gRNA targeting Notch under dU6-3 promoterDepositorInsertnotch gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050K (firefly luciferase)
Plasmid#132422Purposeexpress arrays of gRNA targeting Firefly Luciferase under dU6-3 promoterDepositorInsertfirefly Luciferase gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050U (cinnabar)
Plasmid#132423Purposeexpress arrays of gRNA targeting Cinnabar under dU6-3 promoterDepositorInsertcinnabar gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050V (wingless)
Plasmid#132424Purposeexpress arrays of gRNA targeting Wingless under dU6-3 promoterDepositorInsertwingless gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only