We narrowed to 19,284 results for: cat
-
Plasmid#63589PurposeExpresses a 3xFLAG-tagged TAL protein recognizing a telomere repeat.DepositorInsert3xFVN-Tel-TAL
UseTALENTags3xFLAG-tag, V5-tag, and nuclear localization sign…ExpressionMammalianPromoterCMVAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-agrBD-IV
Plasmid#53440PurposeDerivative of pT7-agrBD-I with a point mutation in the agrD gene to change AIP coding region from type-I to type-IVDepositorInsertagrBD locus (with D29Y mutation in agrD)
UseSynthetic BiologyTagsV5 epitope, 6x HIS (not expressed on agrB or agrD…ExpressionBacterialMutationD to Y mutation of residue 29 of the agrD gene (c…PromoterT7-lacAvailable SinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET21c-IF3mt
Plasmid#31078DepositorInsertMature form human mitochondrial translational initiation factor 3 (MTIF3 Human)
TagsHisExpressionBacterialMutationIncludes coding sequence for the mature form. Ami…Available SinceAug. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 PARL-FLAG-CT H335G
Plasmid#13749DepositorTagsFLAGExpressionMammalianMutationChanged catalytic His 335 to GlyAvailable SinceFeb. 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
p1.1-mCherry
Plasmid#162772PurposeFluorescent reporter for CHO expression studiesDepositorInsertred fluorescent protein
ExpressionMammalianMutationconsensus Kozak sequence (GCCGCCATGG) added befor…PromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
p1.2-GS-eGFP
Plasmid#162771PurposeFluorescent reporter for CHO expression studiesDepositorInsertenhanced green fluorescent protein
ExpressionMammalianMutationconsensus Kozak sequence (GCCGCCATGG) added befor…PromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCALNL-Rheb(S16H)
Plasmid#194204PurposeCre/LoxP-dependent expression of a constitutively active form of Rheb (S16H). Expression of Cre excises a STOP codon before Rheb(S16H), facilitating expression of a constitutively active form of Rheb.DepositorInsertRas Homolog Enriched Protein in Brain (S16H) (RHEB Human)
UseCre/LoxExpressionMammalianMutationS16HAvailable SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV_pMBP-dnVamp2-P2AT2A-EGFP-caax
Plasmid#190153PurposeExpresses dominant-negative Vamp2 (mouse Vamp2 AA 1-94) plus membrane-targeted EGFP in oligodendrocytes; AAV vectorDepositorInsertVamp2 (Vamp2 Mouse)
UseAAVTagsP2AT2A-EGFP-caaxExpressionMammalianMutationTruncation that includes only AA #1-94PromoterMBPAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
SL2-sgTelo-MTSa/BFP/pdCas9-C1
Plasmid#162760PurposeExpressing dCas9 and sgRNA containg MTSa targeting telomeresDepositorInsertdCas9 and sgRNA(SL2-sgTelo-MTSa)
ExpressionMammalianMutationdCas9(nuclease deactivated Cas9)PromoterU6/CMVAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
Venus2-Y705F-STAT3
Plasmid#123173PurposeExpresses Y705F STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
TagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationY705F substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-S727A-STAT3
Plasmid#123175PurposeExpresses S727A STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
TagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationS727A substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSB137 - pL2_pSB90_pNOS::rLUC-I::tNOS_tOCS::fLUC-I::pSTR1
Plasmid#123194Purposebinary plant vector for transient dual luciferase (rLUC & fLUC with introns) expressionDepositorInsertpNOS::rLUC-I::tNOS tOCS::fLUC-I::pSTR1
UseLuciferaseExpressionPlantAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTO_Snf7_LAP
Plasmid#101851PurposeTet-inducible expression of Snf7 from S. cerevisiae with a C-terminal GFP and long linker (LAP tag), compatible with Flp-In recombination for stable integrationDepositorInsertSNF7 (SNF7 Budding Yeast)
UseGateway cloning, flp-frt recombination, tet-induc…TagsLocalization and Affinity Purification (LAP) tagExpressionBacterial and MammalianPromoterCMVAvailable SinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
B270 + SMARCAL1 sgSTOP
Plasmid#100717PurposeB270 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) in combination with ATP1A1 sgSTOPDepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI) and ATP1A1 (SMARCAL1 Human)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
nes374tk/lacZ
Plasmid#47615Purposeused to create transgenic mice expressing LacZ reporter with Nestin enhancerDepositorInsertnestin 2nd intron fragment (NES Human)
UseEnhancer reporterTagsHSV tk promoter and lacZMutation374 bp from 2nd intron (comprising bp 1153 to 152…PromoterHSV tk promoterAvailable SinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/Flag-hINO80 ΔN ΔHSA (520-1556)
Plasmid#29446DepositorAvailable SinceJune 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pIS54 ADAR 3'UTR mut
Plasmid#14488DepositorInsertADAR 3'UTR mutant (ADAR Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationCATTCC’s were changed to AAGTAC'sAvailable SinceMarch 7, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCRI011-pYFAC-pyroA-PgpdA-4xcrRNAarrayelcA-TtrpC
Plasmid#140203PurposeFungal vector to express an LbCas12a crRNA array targeted to Pelca, to be contransformed with pCRI009 containing PelcA-mCherry in a dLbCas12a-VPR strain as proof-of-concept of CRISPRa.DepositorInsertcrRNA array elcA
UseCRISPR and Synthetic BiologyPromoterPgpdAAvailable SinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
p300dAIL KAT LIC 1M
Plasmid#233588PurposeBacterial expression of p300 KAT enzyme with truncated autoinhibitory loopDepositorInsertp300dAIL KAT (EP300 Human)
Tags6xHis MBPExpressionBacterialMutationdeleted amino acids 1523-1554PromoterT7Available SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only