We narrowed to 15,899 results for: grna
-
Plasmid#86350PurposeEncodes gRNA for 3' target of human ARID5BDepositorInsertgRNA against ARID5B (ARID5B Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti_dCas9-2xAM_hIRF-1
Plasmid#92221PurposeLentiviral plasmid expressing dCas9-2xAM and gRNA for human IRF-1 promoterDepositorInsertsSp-dCas9-2xAM tag
gRNA targeting human IRF-1 promoter
UseCRISPR and LentiviralTags2xAM tagExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterCBh and U6Available sinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPA_1
Plasmid#86358PurposeEncodes gRNA for 3' target of human CEBPADepositorInsertgRNA against CEBPA (CEBPA Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_DMAP1_2
Plasmid#86355PurposeEncodes gRNA for 3' target of human DMAP1DepositorInsertgRNA against DMAP1 (DMAP1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_DMAP1_1
Plasmid#86354PurposeEncodes gRNA for 3' target of human DMAP1DepositorInsertgRNA against DMAP1 (DMAP1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ARID5B_2
Plasmid#86351PurposeEncodes gRNA for 3' target of human ARID5BDepositorInsertgRNA against ARID5B (ARID5B Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPG_1
Plasmid#86344PurposeEncodes gRNA for 3' target of human CEBPGDepositorInsertgRNA against CEBPG (CEBPG Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPA_2
Plasmid#86359PurposeEncodes gRNA for 3' target of human CEBPADepositorInsertgRNA against CEBPA (CEBPA Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX330_MED13_iso1_1
Plasmid#135751PurposeEncodes gRNA for 3' target of human MED13_iso1DepositorInsertMED13_iso1 gRNA (MED13 Human)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPG_2
Plasmid#86345PurposeEncodes gRNA for 3' target of human CEBPGDepositorInsertgRNA against CEBPG (CEBPG Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
U6a-T
Plasmid#117209PurposeExpresses gRNA in Aedes aegyptiDepositorInsertu6a promoter-gRNA
UseSynthetic BiologyTagsExpressionInsectMutationPromoterU6Available sinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6d
Plasmid#117224PurposeExpresses gRNA in Aedes aegyptiDepositorInsertHR U6d promoter-gRNA
UseSynthetic BiologyTagsExpressionInsectMutationPromoterU6Available sinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6a
Plasmid#117221PurposeExpresses gRNA in Aedes aegyptiDepositorInsertHR U6a promoter-gRNA
UseSynthetic BiologyTagsExpressionInsectMutationPromoterU6Available sinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF9_2
Plasmid#86347PurposeEncodes gRNA for 3' target of human KLF9DepositorInsertgRNA against KLF9 (KLF9 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF9_1
Plasmid#86346PurposeEncodes gRNA for 3' target of human KLF9DepositorInsertgRNA against KLF9 (KLF9 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_GATAD1_2
Plasmid#104043PurposeEncodes gRNA for 3' target of human GATAD1 along with Cas9 with 2A GFPDepositorInsertGATAD1 gRNA (GATAD1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_GATAD1_1
Plasmid#104042PurposeEncodes gRNA for 3' target of human GATAD1 along with Cas9 with 2A GFPDepositorInsertGATAD1 gRNA (GATAD1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B-Pho2-1/2-2-Csy4
Plasmid#161760PurposeMODULE B Csy4 vector with 6x gRNAs targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pMOD_B2103 - #91061)DepositorInsertgRNAs
UseTagsExpressionBacterialMutationPromoterCmYLCV PromoterAvailable sinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only