We narrowed to 7,426 results for: 11
-
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuetG-DmXRN1_1323-1355-L1323AQ1326A-DmDCP1_1-127_P
Plasmid#147220PurposeBacterial Expression of DmXRN1_1323-1355-L1323AQ1326A-DmDCP1_1-127DepositorInsertDmXRN1_1323-1355-L1323AQ1326A-DmDCP1_1-127 (pcm Fly)
ExpressionBacterialAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuetG-DmXRN1_1312-1355-DmDCP1_1-127_N
Plasmid#147054PurposeBacterial Expression of DmXRN1_1312-1355-DmDCP1_1-127DepositorInsertDmXRN1_1312-1355-DmDCP1_1-127 (pcm Fly)
ExpressionBacterialAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuetG-DmXRN1_1323-1355-DmDCP1_1-127_N
Plasmid#147055PurposeBacterial Expression of DmXRN1_1323-1355-DmDCP1_1-127DepositorInsertDmXRN1_1323-1355-DmDCP1_1-127 (pcm Fly)
ExpressionBacterialAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuetG-DmXRN1_1323-1383-DmDCP1_1-127_N
Plasmid#147056PurposeBacterial Expression of DmXRN1_1323-1383-DmDCP1_1-127DepositorInsertDmXRN1_1323-1383-DmDCP1_1-127 (pcm Fly)
ExpressionBacterialAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1A-DmXRN1-P1339AP1342A-dsRNAres-V5His6_P
Plasmid#147209PurposeInsect Expression of DmXRN1-P1339AP1342A-dsRNAresDepositorInsertDmXRN1-P1339AP1342A-dsRNAres (pcm Fly)
ExpressionInsectMutationone silent mtuation compared to the sequence give…Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-GST-DmNanos_116-163-E151AF152AN155A-V5His6_AC
Plasmid#148466PurposeInsect Expression of DmNanos_116-163-E151AF152AN1555ADepositorInsertDmNanos_116-163-E151AF152AN1555A (nos Fly)
ExpressionInsectAvailable SinceMarch 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
mILK-R349A-EFGP
Plasmid#176898Purposemouse ILK with R349A point mutation cloned into pEGFP-N1DepositorInsertIntegrin-linked kinase (Ilk Mouse)
TagsEGFPExpressionMammalianMutationArginine 349 to AlaninePromoterCNVAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
mILK-R255A-EFGP
Plasmid#176897Purposemouse ILK with R255A point mutation cloned into pEGFP-N1DepositorInsertIntegrin-linked kinase (Ilk Mouse)
TagsEGFPExpressionMammalianMutationArginine 255 to AlaninePromoterCNVAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLB(N)CX-FLAG-CH3 Del33
Plasmid#133724PurposeRetroviral vector with CMV promoter driving mutant form of CH3 domain fragment of human p300 (EP300), with N-terminal FLAG tag.DepositorInsertEP300 (EP300 Human)
UseRetroviralTagsFlagMutationpartial (not complete) p300 fragment, AT and CH3 …PromoterCMVAvailable SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
MTF2_KO_ex11_gRNA-4
Plasmid#131334PurposegRNA to knockout MTF2. This gRNA is also used in Haojie Li et al. Nature 2017. It targets exon 11 of MTF2.DepositorInsertMTF2_KO_ex11_gRNA
UseCRISPRExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shGDF11 #2
Plasmid#83084PurposeLentiviral shRNA vector for inducible knockdown of human GDF11DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-puro-eGFP-HEC1-M4
Plasmid#114036PurposeExpression of HEC1 M4 mutant tagged with GFPDepositorInsertGFP tagged - HEC1 -M4 (NDC80 Human)
ExpressionMammalianMutationM4 (K146E, R153E, K156E)PromoterCMV TetOAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-puro-eGFP-HEC1-M2
Plasmid#114035PurposeExpression of HEC1 M2 mutant tagged with GFPDepositorInsertGFP tagged - HEC1 -M2 (NDC80 Human)
ExpressionMammalianMutationM2 (K81E, N87E, K89E)PromoterCMV TetOAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNAS1b split mCherry NEDD4 WW2 neg ctrl
Plasmid#112030PurposeMode #2 phosphosite negative control (split mCherry, using NEDD4 WW2 binding domain paired with negative control peptide)DepositorInsertNEDD4 WW2 domain fused to C-terminal split mCherry, neg ctrl interacting peptide fused to N-terminal split mCherry
TagsSplit mCherryExpressionBacterialAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMGF130
Plasmid#96971PurposeS. pombe lem2 knockout cassette with hygro resistance geneDepositorInsertlem2 (lem2 Fission Yeast)
ExpressionBacterialMutationwhole ORF deletion and replaced with hygro resist…PromoterN/AAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMGF172
Plasmid#96998Purposeish1 mCherry insertion cassette with ura4+ geneDepositorInsertish1 (ish1 Fission Yeast)
TagsGST and mCherryExpressionBacterialMutationish1 C-terminal domain fused with mCherry + ura4(…PromoterN/AAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUAST-HA, Pbl-A DH domain
Plasmid#69794PurposePebble isoform A, DH domain, in P element-based pUAST vector for Gal4-regulated expression in Drosophila.DepositorInsertPebble DH domain
UseP element-based puast vector for gal4-regulated e…TagsHA-TagExpressionInsectMutationContains only the Pebble DH domainPromoterhsp70Available SinceOct. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTSlb-R756S
Plasmid#60730PurposeExpresses both fragments of T7 RNAP split at position 179. The N-terminal fragment is driven by PLac while the C-terminal fragment is driven by PBAD. C-terminal fragment has the point mutations R756SDepositorInsertsResidues 1-179 of split T7 RNAP
Residues 180-880 of split T7 RNAP
UseSynthetic BiologyExpressionBacterialMutationResidues 1-180 of split T7 RNAP and Residues 180-…Available SinceJan. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTSara-R756S
Plasmid#60725PurposeExpresses both fragments of T7 RNAP split at position 179. Both fragments are driven by PBAD. The C-terminal fragment has the point mutation R756S. Contains a constitutive araC ORFDepositorInsertsResidues 1-179 of split T7 RNAP
Residues 180-880 of split T7 RNAP
UseSynthetic BiologyExpressionBacterialMutationResidues 1-180 of split T7 RNAP and Residues 180-…Available SinceDec. 18, 2014AvailabilityAcademic Institutions and Nonprofits only