We narrowed to 82,682 results for: Tro
-
Plasmid#101133PurposeExpression of SNAP-Tag and CaaX box (Farnesylation Signal) in Mammalian cellsDepositorInsertCaaX Box
TagsSNAP-tag (SNAP26m)ExpressionMammalianPromoterCMVAvailable SinceSept. 27, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
PCMV-intron myc Rab1aWT
Plasmid#46776Purposeexpression of WT Rab1a in mammalian cellsDepositorAvailable SinceNov. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2259 - Intron GG2 - 900 bp
Plasmid#159881PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertIntron GG2 - 900 bp
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2215 - Intron GG3 - 900 bp
Plasmid#159882PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertIntron GG3 - 900 bp
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2214 - Intron GG1 - 900 bp
Plasmid#159880PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertIntron GG1 - 900 bp
ExpressionWormMutationNot applicableAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
PP_072_pAAV_hSyn_DIO-LR-Voltron2-P2A-LR-CheRiff-HA
Plasmid#230988PurposeCo-expressing membrane-localized Voltron2 and membrane-localized CheRiff.DepositorInsertCre-dependent, membrane-localized optopatch for neuronal dendrites
UseAAVExpressionMammalianPromoterhSynAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSIH1-puro-control shRNA
Plasmid#26597PurposeLentiviral control shRNA vector with puromycin selection.DepositorTypeEmpty backboneUseLentiviral and RNAiAvailable SinceDec. 6, 2010AvailabilityAcademic Institutions and Nonprofits only -
pWALIUM-intron 3x UAS attB
Plasmid#206360Purposeincludes two standard UAS cassettes and one UAS cassette designed to co-express shRNAs/shRNA clusters and prodein coding sequencesDepositorTypeEmpty backboneExpressionInsectAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-PTuner DD-linker-M.EcoGII
Plasmid#122082PurposeExpress M.EcoGII with detabilization domain - inducibleDepositorInsertDD-linker-M.EcoGII
UseRetroviralTagsV5 tag on Nter of M.EcoGIIExpressionBacterial and MammalianAvailable SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
PCMV-intron myc Rab2WT
Plasmid#46779Purposeexpression of WT Rab2a in mammalian cellsDepositorAvailable SinceNov. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pIG-828_HA-GD2-28z_CAR_BATF_Retroviral
Plasmid#207505PurposeThis plasmid can be used to generate retrovirus.DepositorInsertBATF, HA-GD2-28z_CAR (BATF Human)
UseRetroviralAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS416-PTEF1-MCP-no_intron
Plasmid#127597Purposelow-copy URA-selectable plasmid, 1xFLAG-MCP under TEF1 promoterDepositorInsert1xFLAG-MCP expression cassette
ExpressionYeastAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAJE-Ma pylRS nitroY/haloY-F5
Plasmid#225684PurposeExpresses Methanomethylophilus alvus pyrrolysine tRNA synthetase engineered for 3-nitroY and 3-haloY under GlnS promoter. Used as a control during Ma Pyl tRNA-synthetase validation.DepositorInsertsM. alvus PylRS 3-NY/HaloY F5
M. alvus Pyl-tRNA(6)
UseMethanomethylophilus alvusMutationCTG125CTT, N166A, V168S, A223C, W239RPromoterGlnS and LppAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-EGFP-Donor
Plasmid#159740PurposeContains EGFP flanked by a splice acceptor and a splice donor. Together with other intron tagging plasmids, it can be used to place the EGFP tag as a synthetic exon into introns of target genes.DepositorInsertEGFP
UseIntron tagging donorAvailable SinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIG-831_HA-GD2-28z_CAR_TFAP4_Retroviral
Plasmid#207508PurposeThis plasmid can be used to generate retrovirus.DepositorInsertTFAP4, HA-GD2-28z_CAR (TFAP4 Human)
UseRetroviralAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLY098-RetroEFS-BCMABBz-WPRE
Plasmid#192199PurposeRetro-BCMACARDepositorAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
FUGW-H1-Scrambled control shRNA
Plasmid#40625DepositorInsertScrambled control shRNA
UseLentiviral and RNAiAvailable SinceOct. 4, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEF5B-FRT-control-APEX
Plasmid#73187PurposeExpresses "control"-APEX (cytosolic) in mammalian cellsDepositorInsertcontrol-APEX (Nphp3 Mouse, Glycine max)
Tagsinternal GFP tagExpressionMammalianMutationchanged glycine 2 to alaninePromoterEF1alphaAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only