We narrowed to 7,588 results for: mCherry
-
Plasmid#195137PurposegRNA in a third generation gRNA backbone with mCherry, targeting region immediately downstream of MDM4, to be used with MDM4_Deletion_Upstream_gRNA_1/2 for MDM4 deletionDepositorInsertMDM4 Deletion Downstream gRNA 2 (MDM4 Human)
ExpressionMammalianAvailable sinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
MDM4_Deletion_Downstream_gRNA_1
Plasmid#195136PurposegRNA in a third generation gRNA backbone with mCherry, targeting region immediately downstream of MDM4, to be used with MDM4_Deletion_Upstream_gRNA_1/2 for MDM4 deletionDepositorInsertMDM4 Deletion Downstream gRNA 1 (MDM4 Human)
ExpressionMammalianAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiSSTe10_ChR2_mCherry (AAV1)
Viral prep#213815-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiSSTe10_ChR2_mCherry (#213815). In addition to the viral particles, you will also receive purified pAAV_BiSSTe10_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the SST interneuron-targeting enhancer E10. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable sinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAT15535_hU6_epegRNA_Ef1a-mCh
Plasmid#251104PurposeepegRNA cloning plasmid + mCherry expressionDepositorInsertpegRNA cloning vector
UseCRISPRAvailable sinceMay 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMCB320 sgCdkn1a.1
Plasmid#227945PurposesgRNA targeting Cdkn1a, mCherry, puromycin resistance, Mammalian expression, Mouse targeting, lentiviral, CRISPRDepositorAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMCB320 sgCdkn1a.2
Plasmid#227946PurposesgRNA targeting Cdkn1a, mCherry, puromycin resistance, Mammalian expression, Mouse targeting, lentiviral, CRISPRDepositorAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
EFS-SpdCas9-Dnmt3A/3L-V1
Plasmid#222498PurposeExpresses EFS promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V1 (R887E) followed by P2A-mCherryDepositorInsertS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V1 (R887E) engineered fusion
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; R887E in Dnmt3APromoterEFSAvailable sinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
EFS-SpdCas9-Dnmt3A/3L-V2
Plasmid#222499PurposeExpresses EFS promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V2 (E814G) followed by P2A-mCherryDepositorInsertS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V2 (E814G) engineered fusion
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E814G in Dnmt3APromoterEFSAvailable sinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mode #2 Library (NEDD4-2 WW2 domain)
Pooled library#111708PurposeEncodes NEDD4-2 WW2 domain and human phosphopeptides fused to split mCherry for Hi-PDepositorExpressionBacterialSpeciesHomo sapiensAvailable sinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Mode #2 Library (NEDD4 WW2 domain)
Pooled library#111707PurposeEncodes NEDD4 WW2 domain and human phosphopeptides fused to split mCherry for Hi-PDepositorExpressionBacterialSpeciesHomo sapiensAvailable sinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Mode #2 Library (14-3-3σ)
Pooled library#111706PurposeEncodes 14-3-3σ and human phosphopeptides fused to split mCherry for Hi-PDepositorExpressionBacterialSpeciesHomo sapiensAvailable sinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Mode #2 Library (14-3-3β)
Pooled library#111705PurposeEncodes 14-3-3β and human phosphopeptides fused to split mCherry for Hi-PDepositorExpressionBacterialSpeciesHomo sapiensAvailable sinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKE12-ISceI-fabp10a:loxP-BFP-loxP-Xla.Ctnnb1
Plasmid#198240PurposeFor I-SceI-mediated transgenesis in zebrafish; fabp10a promoter drives expression of activated β-catenin preceded by a blue fluorescent protein (BFP)-STOP cassette flanked by loxP sitesDepositorInsertsUseZebrafish transgenesisAvailable sinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiLAMP5e3_ChR2_mCherry (AAV1)
Viral prep#213915-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiLAMP5e3_ChR2_mCherry (#213915). In addition to the viral particles, you will also receive purified pAAV_BiLAMP5e3_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the Lamp5 interneuron-targeting enhancer E3. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable sinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJZC33
Plasmid#62330PurposesgRNA + 2x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
CIB-VP64 (B1016)
Plasmid#92037PurposeExpresses CIB1 (Full-length, with endogenous NLS) fused to VP64 activation domain (4xVP16 inserts)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCIB1-VP64 (CIB1 Mustard Weed)
TagsFusion of plant CIB1 with VP64 activation domain.…ExpressionMammalianPromoterCMVAvailable sinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
RFP-(SUMO)10-(SIM)6
Plasmid#122026PurposeMammalian expression plasmid for multivalent scaffold of (SUMO)10-(SIM)6 biomolecular condensates to recruit SIM-containing client proteins.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTagsmCherryExpressionMammalianPromoterCMVAvailable sinceAug. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_Puro_Telo_v2
Plasmid#195139Purpose~100 repeats of the human telomere seed sequence fused to the puromycin resistance gene; digest with BstZ17I-HF and KpnI-HF to obtain transfectable construct for chromosomal arm loss inductionDepositorInsertTelomere (RTEL1 Human)
ExpressionMammalianAvailable sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
OSCA1.2
Plasmid#136593PurposeExpresses the mechanosensitive channel OSCA1.2 in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertOSCA1.2 (AT4G22120 Mustard Weed)
TagspIRES2-mCherryExpressionMammalianPromoterCMVAvailable sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
EF1a_Puro_Telo_v1
Plasmid#195138Purpose~100 repeats of the human telomere seed sequence fused to the puromycin resistance gene; digest with BstZ17I-HF and KpnI-HF to obtain transfectable construct for chromosomal arm loss inductionDepositorInsertTelomere (RTEL1 Human)
ExpressionMammalianAvailable sinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by