We narrowed to 10,498 results for: yeast
-
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW2-NgBR
Plasmid#203165PurposeYeast expression vector for hNUS1DepositorAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW2-NgBR R290H
Plasmid#203167PurposeYeast expression vector for hNUS1 R290HDepositorAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed Free ClLIS1 (M)
Plasmid#182484PurposeYeast integrative plasmid for expressing ERG20(F96W-N127W) (GAL10 promoter) and limonene synthase from Citrus limon (ClLIS1; GAL7 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsFPPS(M)
LS
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10 and GAL7Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed Free deadFPPS-NES
Plasmid#182492PurposeYeast integrative plasmid for expressing ERG20 (GAL10 promoter) and fusion protein deadFPPS-AcNES1 (GAL7 promoter). deadFPPS is ERG20(K197G-K254A), an inactive mutant of ERG20.DepositorInsertsFPPS
deadFPPS-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10 and GAL7Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
3020_pETcon-SARS-CoV-2-RBD_N501Y
Plasmid#184405Purposeyeast surface display of the SARS-CoV-2 Alpha variant RBDDepositorInsertSARS-CoV-2 Alpha Spike receptor binding domain (RBD) (S SARS-CoV-2 virus)
TagsHA and c-MycExpressionYeastMutationN501YAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pESC-LEU-IpgD(C439S)
Plasmid#183673PurposeInducible Shigella flexneri IpgD (catalytically inactive) for expression in yeastDepositorInsertIpgD
ExpressionYeastMutationC439SPromoterGAL1Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNIA-CEN-FLAG-LANS1-Set2
Plasmid#122002PurposeFLAG-LANS-Set2: FLAG-tagged LANS1-Set2 for light control of Set2 localization in yeastDepositorInserthistone methyltransferase SET2 (SET2 Budding Yeast)
UseSynthetic BiologyTagsFLAGExpressionYeastMutationSet2 point mutations K538G, K539S, R549G, K550S, …PromoterADH1Available SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGG442
Plasmid#165616PurposeVector for expression of SpCas9-Zif268 in yeast after assembly with PID fragments: TEF1p-SpCas9::KanR-1xNLS-3xHA-1xNLS-Zif268-1xNLS-CYC1t (KanR cassette in place of the PID)DepositorInsertTEF1p-SpCas9::KanR(in place of PID)-1xNLS-3xHA-1xNLS-Zif268-1xNLS-CYC1t
UseCRISPRTags3x HA, SV40 NLS, Zif268, and c-Myc-like NLSExpressionYeastMutationCorrected homology relative to wild type SpCas9 (…PromoterTEF1Available SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS313_ATP3G919C
Plasmid#120255PurposeExpression of ATP3-7 in yeastDepositorInsertATP3 (ATP3 Budding Yeast)
ExpressionYeastMutationG919 changed to C; Alanine 307 changed to ProlinePromoterATP3Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS313_ATP3mut
Plasmid#120256PurposeExpression of ATP3-67 in yeastDepositorInsertATP3 (ATP3 Budding Yeast)
ExpressionYeastMutationIsoleucine 304 changed to Asparagine; Alanine 307…PromoterATP3Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3568 (YCp LEU2 Rpb1 P1455_E1456InsGGGGGLEVLFQGP(H)10,N1501K; msLink1)
Plasmid#91819PurposeYeast expression of S. cerevisiae Rpb1 with an internal PreScission protease site and 10xHis tag for purification of the linker-CTDDepositorInsertRPO21 (RPO21 Budding Yeast)
Tags10xHisExpressionYeastMutation5xGly linker, PreScission Protease site (LEVLFQGP…PromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3569 (YCp LEU2 Rpb1 P1455_E1456InsGGGGGLEVLFQGP(H)10,K1487N,D1497K; msLink2)
Plasmid#91820PurposeYeast expression of S. cerevisiae Rpb1 with an internal PreScission protease site and 10xHis tag for purification of the linker-CTDDepositorInsertRPO21 (RPO21 Budding Yeast)
Tags10xHisExpressionYeastMutation5xGly linker, PreScission Protease site (LEVLFQGP…PromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
DHC1-mIAA7 Neo
Plasmid#140543PurposeDHC1 tagging with mIAA7DepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
DHC1-mIAA17 Hygro
Plasmid#140544PurposeDHC1 tagging with mIAA7DepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-aC-MSVU-BZ
Plasmid#160426PurposeExpression of c-luciferase from sp. Maristella sp. SVU (Belize)DepositorInsertluciferase
UseLuciferaseTags6x Histidine tag, Yeast alpha secretion factor, c…ExpressionYeastMutationSee depositor comments belowPromoterAOXAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDUAL-Pnmt1-Ost4-GFP
Plasmid#154368PurposeYeast expression of Ost4DepositorInsertOst4 (ost4 Fission Yeast)
ExpressionYeastAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only