We narrowed to 76,753 results for: KAN;
-
Plasmid#114689PurposesgRNA targeting DHC's C-terminal locusDepositorInsertDHC-C sgRNA
Available SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
p201N 1509
Plasmid#55768PurposeContains soybean miRNA miR1509 recognition sequence (CAACCTTGATTTCCTTGATTAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 8, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBTK1052
Plasmid#209542PurposeBTK Type 2 antibiotic resistance cassette for Golden Gate assemblyDepositorInsertType 2 Kanamycin resistance cassette
UseSynthetic BiologyAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
p2RV
Plasmid#193373PurposeContains the scond TALE repeat harboring RV as RVDDepositorInsertRepeat 2 RV
UseTALENAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3RV
Plasmid#193374PurposeContains the third TALE repeat harboring RV as RVDDepositorInsertRepeat 3 RV
UseTALENAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
p4RV
Plasmid#193375PurposeContains the fourth TALE repeat harboring RV as RVDDepositorInsertRepeat 4 RV
UseTALENAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL0_35 [aadA]
Plasmid#198948PurposeLevel 0 partDepositorInsertaadA
UseSynthetic BiologyAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL0_64 [mScarlet]
Plasmid#198975PurposeLevel 0 partDepositorInsertmScarlet-I
UseSynthetic BiologyAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL0_57 [PtetL]
Plasmid#198970PurposeLevel 0 partDepositorInsertPtetL
UseSynthetic BiologyAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL0_44 [hph]
Plasmid#198957PurposeLevel 0 partDepositorInserthph
UseSynthetic BiologyAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL0_38 [Paac(3)-Ia]
Plasmid#198951PurposeLevel 0 partDepositorInsertPaac(3)-Ia
UseSynthetic BiologyAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL0_33 [cat]
Plasmid#198946PurposeLevel 0 partDepositorInsertcat
UseSynthetic BiologyAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL0_23 [pSC101ts ORI]
Plasmid#198936PurposeLevel 0 partDepositorInsertpSC101ts ORI
UseSynthetic BiologyAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL0_99 [bsRBS]
Plasmid#199000PurposeLevel 0 partDepositorInsertbsRBS
UseSynthetic BiologyAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL0_43 [tsr]
Plasmid#198956PurposeLevel 0 partDepositorInserttsr
UseSynthetic BiologyAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL0_78 [ORI_BC_3]
Plasmid#198979PurposeLevel 0 partDepositorInsertORI_BC_3
UseSynthetic BiologyAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL0_88 [ORI_BC_13]
Plasmid#198989PurposeLevel 0 partDepositorInsertORI_BC_13
UseSynthetic BiologyAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL0_92 [ORI_BC_17]
Plasmid#198993PurposeLevel 0 partDepositorInsertORI_BC_17
UseSynthetic BiologyAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL0_83 [ORI_BC_8]
Plasmid#198984PurposeLevel 0 partDepositorInsertORI_BC_8
UseSynthetic BiologyAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL0_53 [TcatA]
Plasmid#198966PurposeLevel 0 partDepositorInsertTcatA
UseSynthetic BiologyAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only