We narrowed to 19,360 results for: Tat
-
Plasmid#76188Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK1A1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA 3.2/V5-DEST CDC42EP1 S192A
Plasmid#69820PurposeExpresses CDC42EP1-V5 in mammalian cellsDepositorInsertCDC42 effector protein (CDC42EP1 Human)
TagsV5ExpressionMammalianMutationS192APromoterCMVAvailable SinceApril 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-CARD14-D176H
Plasmid#69919PurposeExpresses mutant FLAG-CARD14 in mammalian cellsDepositorInsertCARD14 isoform 3 (CARD14 Human)
TagsFLAGExpressionBacterial and MammalianMutationD176HPromoterCMVAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL4-GFP
Plasmid#67398PurposeMammalian expression of hArl4 with C-term GFP tagDepositorInsertARL4 (ARL4A Human)
TagsGFPExpressionMammalianMutationbp 105 A to T; silent mutationPromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYFP-ErbB2ΔC990
Plasmid#66946PurposeMammalian expression of rat ErbB2 ΔC990 tagged with YFPDepositorInsertErbB2 (Erbb2 Rat)
Tags6xHis, V5 Tag, and YFPExpressionMammalianMutationDeletion of C990. (see depositor comment below on…PromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) ZKSCAN1 nt 400-1782 delta440-500 delta1449-1735
Plasmid#60633PurposeZKSCAN1 circular RNA expression plasmid containing minimal sufficient intronsDepositorAvailable SinceJan. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGfa28-nLac
Plasmid#53130PurposeExpression of LacZ driven by partial human gfa2 promoter, expression is localized to a subset of astrocytes in mice.DepositorInsertGfa2 (GFAP Human)
UseMouse TargetingTagsLacZ, NLS, and mP1ExpressionMammalianMutationcontains the A and B regions (bp -1757 to -1489) …Promoterhuman Gfa2Available SinceJuly 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL3-24p3/LCN2-282C/EBP mut-LUC
Plasmid#46868Purposemurine 24p3 minimal promoter with C/EBP mutation k as a luciferase reporterDepositorInsert24p3/lipocalin 2 proximal promoter
UseLuciferaseMutationCEBP site is mutated (see comments)Promoter24p3 promoter (inactive)Available SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGreenII Tfs-494::LUC
Plasmid#44467PurposeExpresses a luciferase gene disrupted by an AtCRU3 TALEN Target 494 site and a frame-shift mutationDepositorInsertA luciferase gene disrupted by an AtCRU3 TALEN Target 494 site and a frame-shift mutation
UseLuciferase; Plant transformationMutationA disruption was made between the first and secon…Promoter35S PromoterAvailable SinceApril 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-ARAP3(C504A)
Plasmid#39485DepositorInsertARAP3(C504A) (ARAP3 Human)
TagsEGFPExpressionMammalianMutationC504A = Arf GAP domain mutationAvailable SinceAug. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-FLAG-KORD-P2A-ArgiNLS-AausFP1
Plasmid#220612PurposeCre-dependent co-expression of FLAG-tagged inhibitory KORD DREADD receptor, and a single-cell discriminating version of AausFP1 as a reporter.DepositorInsertFLAG-KORD-P2A-ArgiNLS-AausFP1
UseAAV and Cre/LoxTagsFLAG; ArgiNLSExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ-p21-HA(RxL)
Plasmid#215111PurposeExpresses p21-HA(RxL) in mammalian cells from an inducible lentiviral vector.DepositorInsertCDKN1A (CDKN1A Human)
UseLentiviralTagsHAExpressionMammalianMutationp21(RxL) denotes mutations: R19A, R20A, L21A, F22…PromoterCMV (Tet inducible)Available SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRN3P-NLS-EGFP-Btgh-3NLS
Plasmid#194469PurposeEncodes for bacterial O-GlcNAcase BtGH84 fused to enhanced GFP and NLSs for effective nuclear localization, in backbone for T3 In Vitro Transcription.DepositorInsertBtGH84
UseFor in vitro transcription from t3 promoter after…TagsSV40 Nuclear Localization Signal, SV40 Nuclear Lo…ExpressionBacterialAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRIPZ-bioGEF-SUMO1nc-PURO
Plasmid#208042PurposeEnables inducible expression of low-affinity Avitag-SUMO1nc; to perform bioE3; nc = non-cleavable mutation; selection with puromycinDepositorInsertSUMO1nc (SUMO1 Human)
UseLentiviralTagsLow-affinity AvitagMutationQ94P Mutation near C-terminus suppresses cleavage…PromotertetO/UBCAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-ChR2-YFP
Plasmid#204345PurposePiggyBac transposon vector suitable for inserting the ChR2-YFP optogenetic actuator driven by the ubiquitous CAG promoter into the genome of mammalian cell lines.DepositorInsertChR2-YFP
TagsYellow fluorescent proteinExpressionMammalianMutationC-terminus (aa315-737) is deleted - PMID: 1461559…PromoterCAGAvailable SinceOct. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-PTPRS-Fc(DAPA)-AviTag-6xHis
Plasmid#157038PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertPTPRS (PTPRS Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-SIGLEC1(Trunc1)-Fc(DAPA)-AviTag-6xHis
Plasmid#157046PurposeMammalian expression of cell-surface protein partial extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertSIGLEC1 (SIGLEC1 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-KIR2DS5-Fc(DAPA)-AviTag-6xHis
Plasmid#156674PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertKIR2DS5 (KIR2DS5 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-LRFN3-Fc(DAPA)-AviTag-6xHis
Plasmid#156903PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertLRFN3 (LRFN3 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceJan. 20, 2023AvailabilityAcademic Institutions and Nonprofits only