We narrowed to 2,685 results for: PREP
-
Plasmid#224493PurposeGateway compatible middle entry clone containing Lifeact-mCherry (RFP F-actin reporter)DepositorInsertLifeact-mCherry-3xHA
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-mCerulean3-TUBB1A (JDW 1367)
Plasmid#224503PurposeGateway compatible middle entry clone containing mCerulean3 fused to TUBB1A for visualizing tubulin in cellsDepositorInsertmCerulean3-TUBB1A
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-TAEL (JDW 1324)
Plasmid#224508PurposeGateway compatible middle entry clone containing TAEL2.0 transcription factor for making binary TAEL system vectors (generating a tissue specific driver)DepositorInsertTAEL
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-Myc-BioID2-MCS1 (JDW 1095)
Plasmid#224510PurposeGateway compatible middle entry clone containing a Myc-tagged BIOID2 constructDepositorInsertMyc-BioID2
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-Myc-BioID2-MCS2 (JDW 1209)
Plasmid#224511PurposeA Gateway compatible middle clone with a Myc-tagged BIOID2 construct followed by a flexible linker and an MCSDepositorInsertMyc-BioID2
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME nls EGFP-Cre (JDW 1329)
Plasmid#224515PurposeA Gateway compatible middle entry clone containing a NLS-EGFP-Cre fusionDepositorInsertnls-EGFP-Cre
UseCre/LoxTagsExpressionMutationPromoterAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME iCre-I (JDW 1203)
Plasmid#224520PurposeA Gateway compatible middle entry clone containing a loxP flanked, self inactivating Cre that contains an intron to prevent recombination in bacteriaDepositorInsertiCre-I
UseCre/LoxTagsExpressionMutationPromoterAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-H2A_mCherry_SV40pA (JDW 967)
Plasmid#224528PurposeA Gateway compatible 3' entry clone containing an H2A mCherry fusion followed by SV40 late polyADepositorInsertH2A-mCherry-SV40pA
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-IRES-H2A-mCherry-SV40-pA (JDW 1256)
Plasmid#224532PurposeA Gateway compatible 3' entry clone containing an IRES H2A mCherry followed by a polyADepositorInsertIRES-H2A-mCherry-SV40pA
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E EFS-rtTA/rtTA3 (JDW 1214)
Plasmid#224533PurposeA Gateway compatible 3' entry clone containing the Human EFS promoter driving rtTA-3rd generation transactivatorDepositorInsertrtTA
UseGateway cloningTagsExpressionMutationPromoterEFSAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-Actin-Vhh-mNeonGreen-HA (JDW 1225)
Plasmid#224534PurposeA Gateway compatible 3' entry clone containing an Actin nanobody fused to mNeonGreen with a c-terminal HA tagDepositorInsertActin-Vhh-mNeonGreen-HA
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-IRES-mTagBFP2-pA (JDW 1361)
Plasmid#224535PurposeA Gateway compatible 3' entry clone containing an IRES-FLAG-NLS-mTagBFP2-pADepositorInsertIRES-FLAG-NLS-mTagBFP2-pA
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-Lifeact- mScarlet-HA (JDW 1247)
Plasmid#224538PurposeA Gateway compatible middle entry clone containing Lifeact-mScarlet-I (far red f-actin reporter)DepositorInsertLifeact-mScarlet-HA
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME H2B mCerulean (JDW 1150)
Plasmid#224543PurposeA Gateway compatible middle entry clone containing a histone H2B fusion to mCerulean to label the nucleusDepositorInsertH2B-mCerulean
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
p5E 5X C120 c-fos min pro (JDW 1241)
Plasmid#224544PurposeA Gateway compatible 5' entry clone containing 5 TAEL transcription factor binding sites and a minimal c-Fos promoterDepositorInsert5x-C120-c-Fos promoter
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-WPRE-SV40-pA (JDW 922)
Plasmid#224545PurposeA Gateway compatible 3' entry clone containing a woodchuck herpes simplex virus regulatory element (WPRE) to stabilize mRNA upstream of an SV40 polyADepositorInsertWPRE-SV40-pA
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-Lig4
Plasmid#220494PurposeTo generate LIG4 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against LIG4 exon 3.DepositorInsertsgRNA targeting LIG4 exon 3 (LIG4 Human)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2ExpressionMutationPromoterEF1a, hU6, and mU6Available sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pStreptagII 3C SMO
Plasmid#234995PurposeExpression of a Strep-tag II labeled on its N-terminus receptor, with the Smoothened (Smo) receptorDepositorInsertSMO (SMO Human)
UseTagsStreptag-II, HRV 3C siteExpressionMammalianMutationPromoterAvailable sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEABR NA 3C FLAG SA
Plasmid#234987PurposeFor production of Extracellular Vesicles (EVs), with the transmembrane region of Neuraminidase protein fused to Streptavidin on the vesicles surfaceDepositorInsertEABR-NA
UseTagsHRV 3C site, FLAG, Strep-Tactin (SA)ExpressionMammalianMutationIn the Streptavidin coding sequence Glu44Val/Ser4…PromoterAvailable sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only