We narrowed to 14,495 results for: SHR
-
Plasmid#139304PurposeKnocking down of human FOXA1 through shRNA and amiRNA targeting FOXA1DepositorInsertshRNA and amiRNA against FOXA1
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRIN-E-shTAF12.364
Plasmid#105572PurposeDox-inducible mir30 MYB shRNA/dsRED expression with GFP marker and neo resistanceDepositorInsertTAF12 shRNA
UseRNAi and RetroviralExpressionMammalianPromoterTREAvailable SinceMay 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
LENC-shTAF12.364
Plasmid#105579Purposeretrovirally express TAF12 shRNA with Neo resistance and mCherry markerDepositorInsertTAF12 shRNA #364
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-Ef1a-mCh
Plasmid#31847PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both mCherry and shRNA to be recombined out of the construct, turning OFF shRNA expression.DepositorTypeEmpty backboneUseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6 for shRNA; Ef1alpha for mCherryAvailable SinceJan. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBMN-AS-YY1
Plasmid#154943PurposeKnocking down of human YY1 through shRNA and amiRNA targeting YY1DepositorAvailable SinceJune 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSicoR (EGFP) shPnky-2
Plasmid#79142PurposeStable expression of shRNA targeting mouse Pnky. The shRNA (and EGFP) can be excised by the addition of CreDepositorInsertshPnky-2 (Gm30731 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6 for the shRNA and CMV for EGFPAvailable SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-Ef1a-mCh-Puro
Plasmid#31845PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both mCherry and shRNA to be recombined out of the construct, turning OFF shRNA expression. Includes puromycin selection.DepositorTypeEmpty backboneUseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6 for shRNA; Ef1alpha for mCherry-puromycinAvailable SinceJan. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-sh4EBP2
Plasmid#81121Purposeexpresses an shRNA targeting murine 4E-BP2DepositorInsert4E-BP2 shRNA (Eif4ebp2 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6Available SinceSept. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO-PHB-4
Plasmid#122231PurposeExpresses shRNA targeting the 3' UTR of human PHBDepositorAvailable SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shAqp4-4
Plasmid#223225Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shAqp4-3
Plasmid#223224Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shAqp4-1
Plasmid#223223Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-PHB-8
Plasmid#122233PurposeExpresses shRNA targeting the coding sequence of human PHBDepositorInsertshRNA targeting PHB (see partial depositor seq) (PHB1 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-PHB-6
Plasmid#122232PurposeExpresses shRNA targeting the coding sequence of human PHBDepositorInsertshRNA targeting PHB (see partial depositor seq) (PHB1 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1A
Plasmid#185382PurposeFor mammalian expression of shRNA: AGGGTAATGGGTTGCGATATG that targets human PPM1ADepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1B
Plasmid#185383PurposeFor mammalian expression of shRNA: GAGCAGAAGAGGATGAATTTA that targets human PPM1BDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
PRS303-240xtetO
Plasmid#44754DepositorInsert240x tetO array and CHRI homology
ExpressionYeastAvailable SinceOct. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSuperRetropuro-IL-6 scramble
Plasmid#19960DepositorInsertpSuperRetropuro-IL-6 scramble
UseRNAi and RetroviralAvailable SinceJan. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pBS-85xtetO-KlURA3
Plasmid#44757DepositorInsert85x tetO array + KlURA3 marker + CHRI1 homology
Available SinceJuly 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.DEST.EGFP
Plasmid#32684PurposeLentiviral cDNA/shRNA gateway destination vectorsDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJuly 1, 2014AvailabilityAcademic Institutions and Nonprofits only