We narrowed to 165,416 results for: addgene
-
Plasmid#237919PurposeEncodes TRBV6-8 allele and TRAC to generate TCRs via cloningDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only
-
TRBV4-2
Plasmid#237906PurposeEncodes TRBV4-2 allele and TRAC to generate TCRs via cloningDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mTurquoise2
Plasmid#239206PurposeAAV construct used as a cell filler to label neurons with mTurquoise2DepositorInsertmTurquoise2
UseAAVPromoterhSynAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
VEEV_KP282671.1_NSP2_Pro_NHisTEV_CThromAvi
Plasmid#234384PurposeBacterial expression for structure determination. May not contain entire coding region of gene.DepositorInsertNsp2_VEEV
TagsLVPRGSSSGLNDIFEAQKIEWHE and MHHHHHHSSGRENLYFQGExpressionBacterialPromoterT7Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
VEEV_KP282671.1_NSP2_FL_NHisTEV_CThromAvi
Plasmid#234383PurposeBacterial expression for structure determination. May not contain entire coding region of gene.DepositorInsertNsp2_VEEV
TagsLVPRGSSSGLNDIFEAQKIEWHE and MHHHHHHSSGRENLYFQGExpressionBacterialPromoterT7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLIK luciferase-V5 neo
Plasmid#220364PurposeLentiviral expression vector for an inducible V5-tagged luciferase constructDepositorInsertluciferase
UseLentiviralTagsV5ExpressionMammalianAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
mPLD3-sgRNA-Cas9-mcherry
Plasmid#199700Purposeencodes sgRNA for mouse PLD3 KO, (target 217-223aa) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterU6 promoterAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK2-J11
Plasmid#218224PurposeTerminates AtU6-promoter driven sgRNA array with two guides, MoClo CompatibleDepositorInsertlinker sequence
UseCRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK2-K3
Plasmid#218221PurposeFuses Guides 1+2 to guides 3+4 in an of AtU6-promter driven sgRNAsDepositorInsertlinker sequence
UseCRISPRAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK4-J11
Plasmid#218225PurposeTerminates AtU6-promoter driven sgRNA array with four guides, MoClo CompatibleDepositorInsertlinker sequence
UseCRISPRAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK6-J11
Plasmid#218226PurposeTerminates AtU6-promoter driven sgRNA array with tsix guides, MoClo CompatibleDepositorInsertlinker sequence
UseCRISPRAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK4-K5
Plasmid#218222PurposeFuses Guides 3+4 to guides 6+6 in an of AtU6-promter driven sgRNAsDepositorInsertlinker sequence
UseCRISPRAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK8-J11
Plasmid#218227PurposeTerminates AtU6-promoter driven sgRNA array with eight guides, MoClo CompatibleDepositorInsertlinker sequence
UseCRISPRAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK6-K7
Plasmid#218223PurposeFuses Guides 5+6 to guides 7+8 in an of AtU6-promter driven sgRNAsDepositorInsertlinker sequence
UseCRISPRAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAS-mak10 gRNA
Plasmid#160385PurposeExpresses guide RNA for targeting MAK10 in yeastDepositorInsertmak10 gRNA
ExpressionYeastPromoterRNA pol III promoter (tRNA-Tyr)Available SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV V5-Mospd1
Plasmid#175132PurposeLentiviral expression of V5-tagged mouse Mospd1DepositorAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV Tyw1-V5
Plasmid#175131PurposeLentiviral expression of mouse Tyw1-V5DepositorAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPATZ1.1.0-gDNA
Plasmid#132476PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertPATZ1 (PATZ1 Human)
UseCRISPRAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only