We narrowed to 81,660 results for: tro
-
Plasmid#52726Purposeretroviral expression of human LIN-41 / TRIM71 containing cysteine to alanine point mutations of all 7 cysteines in the RING domain and 3 N-terminal HA tagsDepositorInsertLIN-41 (TRIM71 Human)
UseRetroviralTags3xHAExpressionMammalianMutationchanged cysteines 12, 15, 61, 66, 69, 91, and 94 …Available SinceJune 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-bio-myc-NES-EGFP
Plasmid#112712PurposeFor tetracycline-inducible expression of bio-myc-NES-EGFP in mammalian cellsDepositorInsertEGFP
TagsHIV Rev nuclear localization signal (NES), biotin…ExpressionMammalianMutationNucleotide sequence optimized for synthetic gene …PromoterCMV with Tet repressor binding sitesAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Laccase2 MCS-HIPK3 Exon
Plasmid#69888PurposeExpresses the human HIPK3 exon 2 circular RNA in DrosophilaDepositorInsertHIPK3 (HIPK3 Human, Fly)
ExpressionInsectMutationExpresses aa1-194 of HIPK3PromoterMetallothionein Promoter (pMT)Available SinceNov. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPHR-EYFP-NLS-VP16
Plasmid#103822PurposeSoluble BLInCR transcription activator (transactivation domain of viral VP16 protein) that is recruited to 'localizer' sites upon blue light illuminationDepositorInsertPHR-EYFP-VP16 (CRY2 Mustard Weed)
ExpressionMammalianMutationVP16: G126T (silent, G42G)PromoterCMVAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
mKate2-DrCav1 in pT3TS-Dest
Plasmid#194293PurposeIn vitro transcription of mKate2 tagged zebrafish caveolin1 from the T3 promoter. The red fluorescent tag is at the N-terminus. Parton lab clone KZWDepositorInsertcaveolin (cav1.S Frog)
UseIn vitro transcription of mrnaAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMY-Lyz2-GSG-mCherry
Plasmid#163346PurposeRetroviral vector to express C-terminally mCherry-tagged murine Lyz2DepositorAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-Bcan-Ntrk1_4
Plasmid#136413PurposeLentiviral expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1. Also constitutively expresses Puromycin linked to TagBFP.DepositorInsertU6_sgRNA(Bcan)_U6_sgRNA(Ntrk1)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-Myb-Qk_1
Plasmid#136415PurposeLentiviral expression of gRNAs targeting intron 4 of murine Qk and intron 9 of murine Myb. Also constitutively expresses Puromycin linked to TagBFP.DepositorInsertU6_sgRNA(Myb)_U6_sgRNA(Qk)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tol2-lyzC-mcherry-2a-CDK2-D145N
Plasmid#121132Purposeneutrophil specific expressionDepositorInsertdre-D145N CDK2 DN (cdk2 Zebrafish)
Tagsmcherry-2aExpressionBacterialMutationD145N point mutation DNPromoterneutrophil specific lyzCAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Bod1l_Sense
Plasmid#124443PurposePlasmid for sense in situ probe in vitro transcriptionDepositorInsertBiorientation of chromosomes in cell division 1-like (Bod1l Mouse)
UseIn situ probePromoterT7Available SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA-mRIN2 dRA/PINCO
Plasmid#108938PurposeRetroviral expression of mRIN2 dRADepositorInsertRas and Rab interactor 2 (Rin2 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationDeletion of RA domain (aa 751-836)PromoterLTRAvailable SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
HA-mRIN2 dRHVPS9/PINCO
Plasmid#108939PurposeRetroviral expression of mRIN2 dRHVPS9DepositorInsertRas and Rab interactor 2 (Rin2 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationDeletion of RHVPS9 domain (aa 455-738)PromoterLTRAvailable SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDX2 ObLiGaRe Donor vector/EPB64
Plasmid#90017PurposeDonor vector for ObLiGaRe/ZFN mediated targeting to CDX2 exon1 locusDepositorInsertMCS flanked by inverted CDX2 ZFN binding sites (CDX2 Human)
ExpressionBacterialAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQCXIB-FLAG-hDIXDC1-L-S592A
Plasmid#61225PurposeRetrovirus expressing long isoform of human DIXDC1DepositorAvailable SinceMarch 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBabe-Hygro-FLAG-hDIXDC1 S592A
Plasmid#61214PurposeRetrovirus expressing long isoform of human DIXDC1DepositorAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
nes714Δ1388-1507tk/lacZ
Plasmid#47616Purposeused to create transgenic mice expressing LacZ reporter with Nestin enhancerDepositorInsertnestin 2nd intron fragment (NES Human)
UseEnhancer reporterTagsHSV tk promoter and lacZMutation714 bp from 3' end of 2nd intron with a dele…PromoterHSV tk promoterAvailable SinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAL149
Plasmid#22275PurposeExpresses PhyB-mCherry with prenylation sequence from Kras, for red-light-induced recruitment of PIF to the plasma membraneDepositorInsertPhyB(1-908) (PHYB Mustard Weed)
UseSynthetic BiologyTagsmCherry-Kras4BCT (prenylation sequence)ExpressionMammalianPromoterCMVAvailable SinceOct. 21, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGA-red-maxi
Plasmid#196337PurposeEasy-MISE toolkit Level 1 destination plasmid for cassette cloning with BsaI-based Golden Gate Assembly; allowing fast postitive clones test with mRFP1 fluorescent protein-based red/white screeningDepositorTypeEmpty backboneUseSynthetic Biology; Golden gate assembly backboneAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D-DIO-mNeonGreen-mScarlet-l-WPRE
Plasmid#223668PurposeCre-dependently expresses mNeonGreen, mScarlet-I in astrocytesDepositorInsertmNeonGreen-mScarlet-l
UseAAV and Cre/LoxPromoterGfaABC1DAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only