We narrowed to 14,234 results for: CAN
-
Plasmid#112954PurposeIn vivo visualization of Transferrin receptors (can be used for colocalization studies)DepositorInsertpTfR
TagsmScarlet-IExpressionMammalianPromoterCMVAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
p-EF1a-CreERT2-3Xflag-T2A-eBFP2
Plasmid#170186PurposeThis Cre-ERT2 expressing construct can be used to inducibly recombine loxp sites. It can be used with poly-loxP containing plasmids to generate timestamp barcodes useful for linage tracingDepositorInsertCreERT2-T2A-eBFP2
UseLentiviralPromoterEF1 alphaAvailable SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPEPX-P3-sgRNAluc
Plasmid#85590PurposeIntegrate plasmid of Streptococcus pneumoniae, which can integrate sgRNA targeting luc gene, which encode luciferase, into the locus between amiF and treR. This vector can be used as the template forDepositorInsertsgRNA targeting firefly luciferase encoding gene
UseCRISPRExpressionBacterialPromoterP3Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFastBac Dual α1B/β2B Tubulin
Plasmid#170553PurposeEncodes codon-optimized human α1B and β2B tubulin for expression in and purification from insect cells.DepositorTagsAP linker, GS linker (GGSGG), His10 tag, L21 enha…ExpressionInsectAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
sAB-K29
Plasmid#204735Purposesynthetic antigen-binding fragment that can specifically recognize K29-linked polyubiquitinDepositorInsertsynthetic antigen-binding fragment that can specifically recognize K29-linked polyubiquitin
Available SinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEA038
Plasmid#224547PurposeBlast-T2A-2xHA-FKPB12(dTagDegron) mouse Nipbl N-term targeting vectorDepositorInsertFKBP12F36V degron (dTAG system), blasticidin, 2xHA tag
UseMouse TargetingAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTH727-CEN-RLuc/staCFLuc
Plasmid#38211DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe last three codons of the full-length Firefly …PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
HsB2AR-mCherry
Plasmid#137785PurposeVisualization of the Beta-2-adrenergic receptorDepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
poly H35S SUMO1
Plasmid#221071PurposeExpression of poly H35S SUMO1 protein under T7 promoterDepositorInsertFive repeats of H35S SUMO1 each separated by (GGS)4 (SUMO1 Human)
TagsHis and MBPExpressionBacterialMutationH35SPromotertacAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Myc CDC4 WT*
Plasmid#16652DepositorInsertCDC4 (FBXW7 Human)
TagsmycExpressionMammalianMutation*Note that this insert is only WT relative to the…Available SinceMarch 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
pFastBac Dual α1B/β3 Tubulin
Plasmid#170552PurposeEncodes codon-optimized human α1B and β3 tubulin for expression in and purification from insect cells.DepositorTagsAP linker, GS linker (GGSGG), His10 tag, L21 enha…ExpressionInsectAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
CAHS2 (pBS0249)
Plasmid#185139PurposeFor the mammalian expression of the tardigrade protein CAHS2. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertCAHS2
ExpressionMammalianAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-EGFP-NLS-3XFLAG-V5
Plasmid#196090PurposeExpresses gfp in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertGFP
TagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianPromoterCAGGsAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
LIC-Z
Plasmid#153543Purposeperform light induced optogenetic clustering of TCR ζ-Chain as described in the associated publicationDepositorAvailable SinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBabe puro-HA-PIK3CA(H1047R;F486S;del)
Plasmid#33255DepositorInsertPIK3CA (PIK3CA Human)
UseRetroviralTagsHemagglutinin (HA)ExpressionMammalianMutationchanged histidine 1047 to arginine and phenylalan…PromoterSV40Available SinceJan. 4, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJEP307-pAAV-EFS(No AgeI)-MCS3-pA
Plasmid#113684PurposeEFS driven Multi Cloning Site-3 without the AgeI restriction enzyme site.DepositorInsertN/A
UseAAVPromoterCytomegalo Virus(CMV)Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
natMX-ins7
Plasmid#195044PurposepFA6a derived selection cassette 5' flanked with tCYC1 transcription terminator, allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertNatR
UseYeast genomic targetingTagstCYC1 S. cerevisiae, pPGK1 C. glabrata, NatR, tPG…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBabe puro-HA-PIK3CA(H1047R;G320E)
Plasmid#33254DepositorInsertPIK3CA (PIK3CA Human)
UseRetroviralTagsHemagglutinin (HA)ExpressionMammalianMutationchanged histidine 1047 to arginine and glycine 32…PromoterSV40Available SinceJan. 4, 2012AvailabilityAcademic Institutions and Nonprofits only -
cmv hTid Short
Plasmid#13709DepositorInserthTid Short (DNAJA3 Human)
ExpressionMammalianAvailable SinceMarch 5, 2007AvailabilityAcademic Institutions and Nonprofits only