We narrowed to 10,082 results for: crispr plasmids
-
Plasmid#218187PurposeTo KO and genetrap mouse Vamp2 simultaneouslyDepositorInsertsgRNA (Vamp2 Mouse)
UseAAV and CRISPRAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEARBOCS-v0- Gfap-TagIN-mCherry
Plasmid#196490PurposeTo tag endogenous mouse GFAP with mCherryDepositorInsertsmCherry
gRNA
UseAAV and CRISPRExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEARBOCS-v0-Vamp2-TagIN-HA
Plasmid#196494PurposeTo tag endogenous mouse VAMP2 with HADepositorInsertsHA
gRNA
UseAAV and CRISPRExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS160
Plasmid#215682PurposeGuide only plasmid targeting chrI split hygromycinR landing padDepositorInsertU6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-ODN-hsRPL3-CterTwStrep
Plasmid#208644Purposefor long single strand DNA donnor preparation for Twin Strep tag knock-in at C ter of human RPL3. Digest with nt.BspQI and nb.BsrDI to get ssDNA. This plasmid will cause re-edit and fail knock-in.DepositorInsertTwin Strep tag with RPL3 genome HomoArm (RPL3 Synthetic, Human)
UseCRISPR; Ssdna donnor preparationTagsTwin StrepAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHACK-QF2-AgU6-mCherry
Plasmid#184530PurposeHACK-compatible plasmid for generating T2A-QF2 knockins in Anopheles mosquitoes with a mCherry selectable marker.DepositorInsertQF2
UseCRISPRPromoterAnopheles U6 promoterAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBM10a
Plasmid#179688PurposeTarget plasmid for context profilingDepositorInsertACA target
ExpressionBacterialAvailable SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-CAAAG
Plasmid#170096PurposedeGFP reporter plasmid with CAAAG PAM upstream of p70a promoterDepositorInsertdeGFP
UseSynthetic BiologyExpressionBacterialPromoterp70aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-CAATG
Plasmid#170097PurposedeGFP reporter plasmid with CAATG PAM upstream of p70a promoterDepositorInsertdeGFP
UseSynthetic BiologyExpressionBacterialPromoterp70aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-GTAAT
Plasmid#170098PurposedeGFP reporter plasmid with GTAAT PAM upstream of p70a promoterDepositorInsertdeGFP
UseSynthetic BiologyExpressionBacterialPromoterp70aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-GTATT
Plasmid#170099PurposedeGFP reporter plasmid with GTATT PAM upstream of p70a promoterDepositorInsertdeGFP
UseSynthetic BiologyExpressionBacterialPromoterp70aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-ATAAC
Plasmid#170095PurposedeGFP reporter plasmid with ATAAC PAM upstream of p70a promoterDepositorInsertdeGFP
UseSynthetic BiologyExpressionBacterialPromoterp70aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP757-1
Plasmid#99493Purpose6XHis::TEV::3XFlag::linker::MycDepositorInsert6XHis::TEV::3XFlag::linker::Myc
ExpressionBacterialAvailable SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP605-1
Plasmid#99482PurposeMyc::TEV::3XFlag::TEV::MycDepositorInsertMyc::TEV::3XFlag::TEV::Myc
ExpressionBacterialAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP686-1
Plasmid#99491PurposeTEV::eGFP::ER::V5::linker::3XFlagDepositorInsertTEV::eGFP::RE::V5::linker::3XFlag
ExpressionBacterialAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP640-2
Plasmid#99487Purpose3XFlag::TEV::V5::mOrange2::V5::TEV::3XFlagDepositorInsert3XFlag::TEV::V5::mOrange2::V5::TEV::3XFlag
ExpressionBacterialAvailable SinceSept. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-ABE8e(V106W)-SpCas9(D10A)-BPNLS-P2A-EGFP (CA77)
Plasmid#208290PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e(V106W) A-to-G base editor with SpCas9(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e(V106W)-SpCas9-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations and V106W in TadA and nSpCas9(D10…PromoterCMV and T7Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9-NRRH-P2A-EGFP (RMD51)
Plasmid#197502PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-NRRH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpCas9-NRRH-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-NRRH(D10A/I32…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9-NRTH-P2A-EGFP (RMD21)
Plasmid#197503PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-NRTH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpCas9-NRTH-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-NRTH(D10A/I32…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpRY-HF1-P2A-EGFP (LM434)
Plasmid#197507PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpRY-HF1(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpRY-HF1-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpRY-HF1(D10A/A61R/N…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only