We narrowed to 11,157 results for: AGA
-
Plasmid#204357PurposeAAV vector for miniDq expression under the control of human synapsin promoterDepositorInsertminiDq-P2A-mCherry
UseAAVTagsmCherryMutationThe third intracellular loop (ICL3) of hM3Dq was …PromoterhSynAvailable SinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pStreptagII 3C SMO
Plasmid#234995PurposeExpression of a Strep-tag II labeled on its N-terminus receptor, with the Smoothened (Smo) receptorDepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEABR NA 3C FLAG SA
Plasmid#234987PurposeFor production of Extracellular Vesicles (EVs), with the transmembrane region of Neuraminidase protein fused to Streptavidin on the vesicles surfaceDepositorInsertEABR-NA
TagsHRV 3C site, FLAG, Strep-Tactin (SA)ExpressionMammalianMutationIn the Streptavidin coding sequence Glu44Val/Ser4…Available SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmCherryC2-Gephyrin P1
Plasmid#68820PurposemCherry tagged Geph for mammalian expressionDepositorInsertGephyrin (Gphn Rat)
TagsmCherryExpressionMammalianMutationsilent mutations on internal EcoRI site. Gephyrin…PromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCW-HA-hRb-delta-CDK-T373D-S608D-S612D-puro
Plasmid#212675PurposeExpress tagged hRb phosphosite mutantDepositorInsertRb (RB1 Human)
UseLentiviralTagsHAMutation15 CDK phospho-sites are mutated to alanines, and…PromoterTREAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX335-NQL002-WAPL-sgRNA1
Plasmid#175550PurposeFor transient expression of spCas9-nickase and one sgRNA targeting the mouse WAPL locus. Use together with pX335-NQL003-WAPL-sgRNA2 targeting construct.DepositorInsertspCas9-nickase and sgRNA against mouse WAPL STOP Codon
UseMouse TargetingExpressionMammalianAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUDE710
Plasmid#103020Purposeexpression of a Cpf1 programming crRNA targeting ADE2 and HIS4 (crADE2-3 crHIS4-4.S)DepositorAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCR3-FLAG-Gephyrin GC
Plasmid#68818PurposeFlag tagged mammalian expression of GC domainDepositorAvailable SinceAug. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_1
Plasmid#155065PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR3-FLAG-Gephyrin G
Plasmid#68817PurposeGeph G domain expression in mamalian cellsDepositorAvailable SinceAug. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-H2B-PAmCherry-FRT
Plasmid#247337PurposeExpresses photoactivatable H2B-Cherry under EF1 promoter and can be integrated into FRT siteDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR Gal4-UAS_3XFlag_4D5-5_CAR-mCherry_pGK_BFP
Plasmid#247572PurposeGAL4/UAS expression of a CAR against HER2 and mCherry with constitutive BFPDepositorInsertGAL4/UAS expression of a CAR against HER2 - mCherry and BFP constitutive
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRRL-mouse cGAS #2-gRNA-Cas9-Puro
Plasmid#186891PurposegRNA targeting mouse cGAS (with Cas9 insert)DepositorInsertCas9 (Cgas Mouse)
UseLentiviralAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK alfa mouse
Plasmid#224576PurposeNegative Control for downregulation of the expression of human DGK alfa in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-CAPRIN1-ts1
Plasmid#174229PurposeCAPRIN1 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(VENTX_5-5)-PGKpuroBFP-W
Plasmid#211993PurposeExpress gRNA against VENTX with puro and BFPDepositorInsertsgRNA targeting VENTX (VENTX Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shFDPS #2
Plasmid#198760Purposeconditional knockdown of FDPSDepositorInsertshFDPS #2 (FDPS Human)
ExpressionMammalianAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon5
Plasmid#177763PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_gRNA_H19-DMR-1
Plasmid#159929PurposeSpecific gRNA against mouse H19-DMR cloned in the pX330 backbone (Addgene Number 42230). Deletion of H19-DMR in mouse ESC.DepositorInsertgRNA mouse H19-DMR (H19-icr Mouse)
UseCRISPR and Mouse TargetingExpressionMammalianPromoterU6, CBhAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only