We narrowed to 11,552 results for: ANG
-
Plasmid#206029PurposeExpresses the SNARE motif of human VAMP3 mutant S44A in bacteriaDepositorInsertVesicle-associated membrane protein 3 (VAMP3 Human)
Tagshis-tagExpressionBacterialMutationchanges serine 44 to alaninePromoterT7Available SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
BPK1520-sgRNA GLB1
Plasmid#184378PurposeExpresses a sgRNA to edit GLB1 gene NM_000404.2_c.907A>GDepositorAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG007
Plasmid#231311PurposeVector part for BEVA; BEVA2.0 Position 3 pMB1 narrow broad host range origin of replication with oriT, CmR.DepositorInsertBEVA2.0 Position 3 pMB1 narrow broad host range origin of replication with oriT, CmR.
ExpressionBacterialAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACB143
Plasmid#222214PurposeFor recombinant expression of vanB (PP_3737 from Pseudomonas putida) with the A24P mutation and an N-terminal thrombin-cleavable His tagDepositorInsertvanB(A24P)
TagsN-terminal, thrombin-cleavable 6x His tagExpressionBacterialMutationChanged Alanine 24 to ProlinePromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB4650
Plasmid#215265PurposeTU for the copper regulated expression of the PhiC31 recombinase.DepositorInsertCBS:miniDFR:PhiC31:tNos
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB1203
Plasmid#215369PurposeTU for the expression of the silencing suppressor P19 driven by the 35s promoterDepositorInsert35s:P19:tNos
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJune 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB4193
Plasmid#215251PurposeTU for the expression of the CIB1 gene fused to the VPR activation domain under the P35S promoter and TNOS terminator in alpha1DepositorInsertP35S:CIB1:VPR:TNOS
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB3668
Plasmid#215243PurposeTU for the expression of mAID (N-tag): AcrIIA4 w/o NLS protein Codon optimized for N. benthamiana expression under the regulation of the 35S promoter and TNOS terminatorDepositorInsertP35S:mAID:AcrIIA4:TNOS
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB1531
Plasmid#215242PurposeTU for constitutive expression of Streptomyces phage phiC31 integrase. Catalyzes site-specific recombination between phiC31 attB and attP sites. Contains SV40 NLS. N. benthamiana codon optimized.DepositorInsertPNos:PhiC31:TNos
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7CFE1_EVD68_VP12A_C107R
Plasmid#212982PurposeEncodes EV-D68 MO/14/18947 VP12A with active site mutation optimized for expression in mammalian transcription/translation extractsDepositorInsertEV-D68 MO/14/18947 VP12A C107R
UseMammalian cell free protein expressionTagsHAMutationchanged cysteine 107 from 2A to ArgininePromoterT7Available SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7CFE1_EVD68_3ABCD_C147R
Plasmid#212980PurposeEncodes EV-D68 MO/14/18947 3ABCD with active site mutation optimized for expression in mammalian transcription/translation extractsDepositorInsertEV-D68 MO/14/18947 3ABCD C147R
UseMammalian cell free protein expressionTagsHAMutationchanged cysteine 147 from 3C to argininePromoterT7Available SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgWAVE2-2
Plasmid#210136Purposeknock out WAVE2 in mammalian cellsDepositorInsertActin-binding protein WASF2 (WASF2 Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgWAVE2-1
Plasmid#210135Purposeknock out WAVE2 in mammalian cellsDepositorInsertActin-binding protein WASF2 (WASF2 Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-UCK2_sgRNA2
Plasmid#201633PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertUCK2 (UCK2 Human)
UseCRISPR and LentiviralAvailable SinceJuly 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-SNRPA_sgRNA1
Plasmid#201622PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertSNRPA (SNRPA Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-SNRPA_sgRNA2
Plasmid#201623PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertSNRPA (SNRPA Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-UCK2_sgRNA1
Plasmid#201632PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertUCK2 (UCK2 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBMN HA-ATG13(W50D)
Plasmid#188639PurposeFor expression of human ATG13(W50D)DepositorInsertATG13 (ATG13 Human)
UseRetroviralTagsHAExpressionMammalianMutationChanged tryptophan 50 to aspartic acidAvailable SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-ZNF354C_mutant_D17A-V18A
Plasmid#194184PurposeExpresses ZNF354C with mutated KRAB domain (D17A, V18A mutation)DepositorInsertZNF354C (ZNF354C Human)
TagsMyc-DDKExpressionMammalianMutationKRAB domain mutant D17A/V18APromoterCMVAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only