We narrowed to 28,294 results for: cmv promoter
-
Plasmid#67401PurposeMammalian expression of hArl6 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pBS-L1PA1CH blast
Plasmid#69612PurposeExpresses a blasticidin tagged codon optimized L1PA1DepositorInsertL1PA1
Tagsblast cassetteExpressionMammalianPromoterCMVAvailable SinceOct. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBS-L1PA1CH_blast rescue
Plasmid#69611PurposeExpresses a blasticidin tagged codon optimized L1PA1 designed to recover insertsDepositorInsertL1PA1
Tagsblast rescue cassetteExpressionMammalianPromoterCMVAvailable SinceOct. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCLC-mEos2
Plasmid#38010DepositorInsertClathrin, light polypeptide (LCa) (Clta Mouse)
TagsmEos2ExpressionBacterial and MammalianPromoterCMVAvailable SinceSept. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
NG0886 pCI-TPI-WT-4H
Plasmid#65801PurposeNMD reporter mRNADepositorInsertTPI (TPI1 Human)
Tags4H (4 copies of short beta-globin 3'UTR for …ExpressionMammalianPromoterCMVAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
PTH2R-Tango
Plasmid#66490PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
RXFP3-Tango
Plasmid#66494PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
SSTR1-Tango
Plasmid#66502PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
NTSR2-Tango
Plasmid#66458PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
MC2R-Tango
Plasmid#66428PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
MCHR1-Tango
Plasmid#66432PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
MRGPRE-Tango
Plasmid#66436PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
NPFF2-Tango
Plasmid#66451PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
HCTR1-Tango
Plasmid#66398PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
HRH2-Tango
Plasmid#66401PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
GPR85-Tango
Plasmid#66378PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
GPR17-Tango
Plasmid#66336PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
GPR182-Tango
Plasmid#66341PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
GPR27-Tango
Plasmid#66349PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
GPR114-Tango
Plasmid#66305PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
GPR146-Tango
Plasmid#66322PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
GAL2-Tango
Plasmid#66289PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
CYSLTR1-Tango
Plasmid#66266PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
AVPR1B-Tango
Plasmid#66226PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
BB3-Tango
Plasmid#66228PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX400 Campylobacter lari CF89-12 Cas9
Plasmid#68336PurposeCampylobacter lari CF89-12 Cas9DepositorInsertClCas9
UseCRISPRTagsHA and NLSExpressionMammalianPromoterCMVAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
hBACCS2
Plasmid#67625PurposeMammalian expression of hBACCS2, a human blue light-activated Ca2+ channel switchDepositorInserthBACCS2
ExpressionMammalianPromoterCMVAvailable SinceAug. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s(alpha3beta5)
Plasmid#55799PurposeThis G protein alpha-s mutant exhibits increased affinity for and decreased ability to be activated by Gs-protein-coupled receptors as well as decreased ability to activate adenylyl cyclase.DepositorInsertG protein alpha-s with alpha-i2 substitutions in alpha3/beta5 loop (Gnas Rat)
Tagsinternal EE epitope (residues 189-194 in alpha-s …ExpressionMammalianMutationN271K, K274D, R280K, T284D, I285T in alpha-s sequ…PromoterCMVAvailable SinceJuly 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC41
Plasmid#62332PurposesgRNA (no RNA aptamer addition) with PCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
PCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
PA-TagRFP-Alpha-5-Integrin-12
Plasmid#62791PurposeLocalization: Focal Adhesions, Excitation:N/A, Emission:N/ADepositorAvailable SinceApril 1, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits