We narrowed to 21,836 results for: SPR
-
Plasmid#76235Purpose3rd generation lentiviral gRNA plasmid targeting human PLK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
CD2 gRNA (BRDN0001146864)
Plasmid#75827Purpose3rd generation lentiviral gRNA plasmid targeting human CD2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SIK3 gRNA (BRDN0001144776)
Plasmid#75754Purpose3rd generation lentiviral gRNA plasmid targeting human SIK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SIK3 gRNA (BRDN0001148297)
Plasmid#75755Purpose3rd generation lentiviral gRNA plasmid targeting human SIK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SIK3 gRNA (BRDN0001148836)
Plasmid#75756Purpose3rd generation lentiviral gRNA plasmid targeting human SIK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SIK3 gRNA (BRDN0001149197)
Plasmid#75757Purpose3rd generation lentiviral gRNA plasmid targeting human SIK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIB2 gRNA (BRDN0001144754)
Plasmid#75602Purpose3rd generation lentiviral gRNA plasmid targeting human TRIB2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIB2 gRNA (BRDN0001148141)
Plasmid#75603Purpose3rd generation lentiviral gRNA plasmid targeting human TRIB2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIND20-KNL1-rvsf_aaaa-dCas9
Plasmid#248562PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertKNL1-rvsf_aaaa-dCas9
UseCRISPRTagsHA, 2xNLSExpressionMammalianMutationKNL1 RVSF58-61AAAA; Cas9 D10A, H840APromoterTRE, miniCMVAvailable SinceMay 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-KNL1-rvsf_aaaa-dCas9
Plasmid#248567PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertKNL1-rvsf_aaaa-dCas9
UseCRISPRTagsHA, 2xNLSExpressionMammalianMutationKNL1 RVSF58-61AAAA; Cas9 D10A, H840APromoterCMV, TetO2Available SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJAT62
Plasmid#204301PurposeExpress phiC31 under control of D. melanoagaster vasa promoter, with Vasa 3’UTR.DepositorInsertie1-EGFP
UseCRISPRPromoterie1Available SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBBK80 pHomL-RPL18Bp-Scarlet(rfp)-Link-VAM3-SSA1t-HomR (AmpR)
Plasmid#179064PurposeVector containing a yeast integration cassette for RPL18B-driven expression of Scarlet(rfp)-Link-VAM3, a marker for the vacuoleDepositorInsertRPL18Bp-Scarlet(rfp)-Link-VAM3
ExpressionYeastAvailable SinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK70 pHomL-RPL18Bp-Scarlet(rfp)-Link-TUB1-SSA1t-HomR (AmpR)
Plasmid#179054PurposeVector containing a yeast integration cassette for RPL18B-driven expression of Scarlet(rfp)-Link-TUB1, a marker for the microtubulesDepositorInsertRPL18Bp-Scarlet(rfp)-Link-TUB1
ExpressionYeastAvailable SinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
KAT5 sgRNA1
Plasmid#138187Purpose3rd generation lentiviral gRNA plasmid targeting human KAT5DepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
KAT5 sgRNA2
Plasmid#138188Purpose3rd generation lentiviral gRNA plasmid targeting human KAT5DepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP311-pAAV-EFS-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113688PurposeSaCas9 driven by EFS. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACS.DepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSPromoterCytomegalo Virus(CMV)Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP312-pAAV-CMV-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113689PurposeSaCas9 driven by CMV. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACSDepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSPromoterCytomegalo Virus(CMV)Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
YES1 gRNA (BRDN0001148961)
Plasmid#77967Purpose3rd generation lentiviral gRNA plasmid targeting human YES1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
YES1 gRNA (BRDN0001145317)
Plasmid#77965Purpose3rd generation lentiviral gRNA plasmid targeting human YES1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only