We narrowed to 34,202 results for: CMV
-
Plasmid#228735PurposeExpresses domain inlaid iNme2Smu nCas9 (D16A)-i1-ABE8e base editor with linker-10 in mammalian cellsDepositorInsertDomain inlaid iNme2Smu nCas9 (D16A)-i1-L10
UseCRISPRExpressionMammalianMutationNme2-Cas9, Smu PID, D16A D844G E868K K870R D873A …PromoterCMVAvailable sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS2713-CMV-iNme2-ABE8e-i1-L10
Plasmid#228734PurposeExpresses domain inlaid iNme2 nCas9 (D16A)-i1-ABE8e base editor with linker-10 in mammalian cellsDepositorInsertDomain inlaid iNme2 nCas9 (D16A)-i1-L10
UseCRISPRExpressionMammalianMutationNme2-Cas9 D16A D844G E868K K870R D873A D911G K929…PromoterCMVAvailable sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV(gRNA)-CMV-eGFP-U6(sgCTG)
Plasmid#216732PurposeContains a eGFP gene along with a U6 promoter driving the sgCTG (target sequence: (CUG)6). Used with the HD iPSC-derived astrocytesDepositorPublicationInsertsgCTG lentiviral guide RNA with eGFP tag
UseCRISPR and LentiviralExpressionMammalianPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-GFP-Puro_TAL1-short
Plasmid#210641PurposeOverexpression of TAL1-shortDepositorAvailable sinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2T-CMV-evoCjCas9-eAID-BlastR
Plasmid#194062PurposeMammalian expression of evoCjCas9 eAIDDepositorInsertevoCjCas9-eAID
UseCRISPRExpressionMammalianAvailable sinceSept. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-paGFP-bPAC-CAAX
Plasmid#204671PurposeMammalian expression of membrane-bound bPAC tagged with paGFP for cAMP productionDepositorPublicationInsertpaGFP-bPAC-CAAX
UseLentiviralTagsMycExpressionMammalianPromoterCMVAvailable sinceSept. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-CMV-Drosha (NLS-P426)
Plasmid#171538PurposeEncodes mutant human Drosha proteinDepositorInsertDROSHA (DROSHA Human)
ExpressionMammalianMutationan SV40 NLS sequence (PKKKRKVGI) insertion into t…Available sinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV-10xQb oligo-library based
Plasmid#158201PurposeCassette of 10 different binding sites with high affinity to QB phage coat protein, as extracted from the oligo pool experiment.DepositorInsert10 binding sites of QB based on oligo library experiment
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgKcnj6
Plasmid#159913PurposeMutagenesis of Kcnj6DepositorInsertKcnj6 (Kcnj6 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgKcnq3
Plasmid#159911PurposeMutagenesis of Kcnq3DepositorInsertKcnq3 (Kcnq3 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEXfrt-SaCas9-U6-sgNtsr1
Plasmid#159910PurposeMutagenesis of Ntsr1DepositorInsertNtsr1 (Ntsr1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-SMCHD1-R1868*-3xFLAG
Plasmid#130679PurposeExpresses human SMCHD1 R1868* with a C-terminal 3xFLAG tagDepositorInsertSMCHD1 R1868* (SMCHD1 Human)
Tags3xFLAGExpressionMammalianMutationR1868_V2005delinsXPromoterCMVAvailable sinceJune 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRC/CMV-TYK21054-5FF-VSV
Plasmid#139347PurposeExpression of TYK2 protein mutated in the two tyrosines (Y1054F/Y1055F) of the activation loopDepositorInsertTYK2 cDNA with 267nt of 5' UTR (TYK2 Human)
ExpressionMammalianMutationV362F-Y1054F-Y1055FPromoterCMVAvailable sinceJune 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
KI(GAPDH)-P2A-EGFP-CMV-NeoR
Plasmid#114009PurposeHDR-cassette to target chicken GAPDH gene for EGFP expression under control of the endogenous promoter. The cassette contains NeoR gene for positive clone selection and DTA gene for negative selectionDepositorInsertsExpressionMammalianPromoter-, CMV, and endogenous promoter (chicken GAPDH in…Available sinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-SMCHD1-Exon37-48-3xFLAG
Plasmid#130688PurposeExpresses human SMCHD1 Exon37-48 with a C-terminal 3xFLAG tagDepositorInsertSMCHD1 Exon37-48 (SMCHD1 Human)
Tags3xFLAGExpressionMammalianMutation1M_T1522delinsMPromoterCMVAvailable sinceSept. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-SMCHD1-Exon1-36-3xFLAG
Plasmid#130681PurposeExpresses human SMCHD1 Exon1-36 with a C-terminal 3xFLAG tagDepositorInsertSMCHD1 Exon1-36 (SMCHD1 Human)
Tags3xFLAGExpressionMammalianMutationD1523_V2005delinsXPromoterCMVAvailable sinceSept. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV GFP-GABARAPL1 G116
Plasmid#123119PurposeExpresses EGFP-GABARAPL1 G116 in mammalian cells.DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 1 (GABARAPL1 Human)
TagsEGFPExpressionMammalianMutationDeleted amino acid 117. Stop codon after G116PromoterCMVAvailable sinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLU-CMV-Flag-hSesn2 D407A
Plasmid#111795PurposeMammalian expression or 3rd generation lentivirus generation of hSesn2DepositorAvailable sinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLU-CMV-Flag-hSesn2 R419A
Plasmid#111792PurposeMammalian expression or 3rd generation lentivirus generation of hSesn2DepositorAvailable sinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only